... opt/atlas/12.0.8/cmtsite/setup.sh -tag=<release>[,<mode>] # # projects # . opt / atlas / 12.0.8 / cmtsite /setup.sh -tag= project , release [, mode ] # # Report bugs to hn- atlas -releaseKitProblem@cern.ch , atlas -sw-installation@cern.ch . # set CMTSITE STANDALONE set SITEROOT / opt / atlas / 12.0.8 macro ATLAS_DIST_AREA ${ SITEROOT } # use optimised version by default apply_tag opt apply_tag setup apply_tag projectArea ...

Еще в разделе: (Показать все результаты (>2) - lhe.sinp.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>10) - belyakov.imec.msu.ru/ )

Nuclear Instruments and Methods in Physics Research B 206 (2003) 902ґ906 www.elsevier.com/locate/nimb Generation of the large current cluster ion beam T. Seki a c a,b,* , J. Matsuo a, G.H. Takaoka a, I. Yamada b,c Ion Beam Engineering Experimental Laboratory, Kyoto University, Sakyo, Kyoto 606-8501, Japan b Collaborative Research Center for Cluster Ion ... The intensity of neutral cluster beam increased with source gas pressure. ... The beam current increased with source gas pressure. ...

Еще в разделе: (Показать все результаты (>72) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Articles_GSIB/nimb237_455_1maclasterionSource.pdf
• http://danp.sinp.msu.ru/LIIWM/ArXiv-0904.2151v1_Khodyrev2009.pdf
• http://danp.sinp.msu.ru/LIIWM/Munteanu.pdf

A General Course of Analytical Chemistry . ... A general course of analytical chemistry is taught (including seminars, lectures and practical tasks) to students of follow deparments: . Chemical Department . ... Geological Department . Geographical Department . ... The special courses also is tought to students of III-IV year of education and postgraduate students: . Introduction to contemporary analytical chemistry . ... The collecive of Analytical Division under the direction of acad. ...

Еще в разделе: (Показать все результаты (>21) - analyt.chem.msu.ru/ )

... Information for the applicants . Contact information . ... Bioengineering and bioinformatics? Applicants who passed entering exams with the highest scores are free from any tutorial fees (state-funded). ... The annual FBB tutorial fee is 261 600 rubles per academic year. ... 119234, Moscow, GSP-1, Leninskiye Gory, MSU, 1-73, . Faculty of Bioengineering and Bioinformatics, office 433. ... MSU information office +7 (495) 939-10-00 . ... 2016 Faculty of Bioengineering and Bioinformatics, . ...

Еще в разделе: (Показать все результаты (>2) - en.fbb.msu.ru/ )

• Information for the applicantsтАФ Faculty of Bioengineering and Bioinformatics,

General Information . News . Organizing Committee . ... Registered participants . Symposium expenses . ... Presentation information . ... Travel information . Contact information . 14 European Symposium on . Gas Phase Electron Diffraction . ... Participants interested in ordering a taxi to travel from airports to MSU and back are welcome to send appropriate requests to the Organizing Committee by using the email address in the Contact Information. ...

Еще в разделе: (Показать все результаты (>3) - ged.chem.msu.ru/ )

Вы посетили: activ_engl.html . ... История кафедры . ... Editor of the special issue of the journal Linear Algebra and its Applications devoted to Idempotent and Tropical Mathematics, 2010 . Editor of the journal Fundamental and Applied Mathematics . ... Linear Algebra and its Applications . Linear and Multilinear Algebra . ... Electronic Journal of Linear Algebra . ... staff/guterman/activ_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>21) - halgebra.math.msu.su/ )

• Зайцев Михаил Владимирович

... Land Hydrology . ... Recreational Geography and International Tourism . ... Economic and Social Geography of Russia . ... Departments . ... Main accomplished research: River hydrology, limnology, hydrometry, water quality, flow hydraulics, hydrological predictions, fluvial processes, hydrophysics, hydrogeology, water management, water ecology. ... Large international conferences were organized by Hydrology Department for the last years ? for example X Symposium on River Sedimentation (2007). ...

Еще в разделе: (Показать все результаты (>39) - eng.geogr.msu.ru/ )

• Department of Landscape Geochemistry and Soil Geography
• Recreational Geography and Tourism

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>13) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf

... В данном разделе приводятся публикации проекта по созданию семейства реконфигурируемых вычислительных систем в рамках государственного контракта N 02.524.12.4002 от 20 апреля 2007 г. федеральной целевой программы "Исследования и разработки по приоритетным направлениям развития научно-технологического комплекса России на 2007-2012 годы". ... Материалы Международной научной конференции "Параллельные вычислительные технологии" (ПаВТ 2008), г. Санкт-Петербург, 29 - 31 января 2008, Россия. ... Минск,...

Еще в разделе: (Показать все результаты (>29) - fpga.parallel.ru/ )

• Системное программное обеспечение
• Технологии программирования
• Программное обеспечение компьютеров с реконфигурируемой архитектурой

... Кафедра существует с момента основания факультета ВМК МГУ в 1970 году. ... развитие методов верификации программ и технологий программирования на основе моделей . ... Спецсеминары кафедры     Спецкурсы кафедры     Просеминар для 2 курса Пропустить доступные курсы . ... Корныхин Е.В. Учитель: Денис Буздалов . ... Учитель: Евгений Корныхин . ... от Евгений Корныхин - вторник, 11 марта 2014, 18:21 . 13 марта состоится очередное заседание просеминара кафедры. ... История кафедры Пропустить Навигация . ...

93. Research interests

94. Admission committee | MSU Higher school of management and innovation

95. Хроника

96. Кафедра динамической геологии. Заглавная страница.

97. http://nanofluidics.phys.msu.ru/paper/jpcm2011.pdf

98. http://dfgm.math.msu.su/files/koudr/publ3eng.pdf

99. Кафедра квантовой теории и физики высоких энергий

100. ejudge.cs.msu.su