... Научно-методический совет по иностранным языкам . ... Факультет иностранных языков и регионоведения . МГУ им. М.В. Ломоносова. Центр Дистанционного Образования . ... The Scientific and Methodological Council on Foreign Language Teaching . ... в обучении иностранным языкам и межкультурной коммуникации", . ... факультета иностранных языков и регионоведения . ... Педагогические технологии обучения языку с применением ИКТ; . ... Дидактические аспекты дистанционного обучения иностранным языкам; . ...

Еще в разделе: (Показать все результаты (>10) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр Дистанционного обучения.

Козлов А.Н. Кинетика ионизации и рекомбинации в канале плазменного ускорителя. Известия РАН, механика жидкости и газа. 2000, ? ... Kozlov A.N. Modeling of rotating flows in the plasma accelerator channel with longitudinal magnetic field. ... Kozlov A.N. Plasma flow peculiarities in accelerator channel with longitudinal magnetic field. ... Kozlov A.N., Zaborov A.M. Formation of the current attachments in plasma accelerator channel under influence of the longitudinal magnetic field. ...

Еще в разделе: (Показать все результаты (>22) - compmech.math.msu.su/ )

• Список публикаций - А. Х. Пергамент - Кафедра вычислительной механики

Sign in Register . ... Resources . ... info@ecfs.msu.ru . All contacts . ... Home Resources Projects CIMMYT Informa 1855 . 06 October 2015 . Climate change figures prominently in todayтАЩs Informa, with reports on how the phenomenon will affect maize farming in southern Africa and on efforts to generate heat resilient maize for Asia. Researchers in Africa also attended training on how to breed for insect resistance in maize. ... To leave a comment you must log in or register . ...

Еще в разделе: (Показать все результаты (>12) - ecfs.msu.ru/ )

• Online Consultation on Network and Partnerships in the area of Food Security |

Эталонное тестирование окружающей среды самых больших ТЭС на твердом топливе в США. ... С. 182-192. ... Хотя эффективное управление этих типов ТЭС критическое к локальным, национальным и глобальным проблемам окружающей среды, немногие исследования сосредоточены на измерении эффективности и совершенствовании эффективности энергетики. ... При использовании многокритериальной непараметрической производственной модели (охватывающей данные анализа) определено множество протоколов эффективности. ...

Еще в разделе: (Показать все результаты (>192) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=5&subtheme=22&from=&ref_ind=0301000451
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=1&subtheme=21&from=0&ref_ind=0617104267
• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=6&subtheme=15&from=0&ref_ind=0207000102

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics , DEPNI . ... Team . ... Doctor of Science, Professor, Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics . ... PhD, Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics . ... PhD, Lomonosov Moscow State University, Physics Faculty . ... Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics . ... Physics Department, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>20) - cdfe.sinp.msu.ru/ )

• CDFE =>Online services =>Универсальная объединенная система по атомным ядрам и
• ЦДФЭ => Базы данных => Калькулятор и графическая для параметров атомных ядер и
• ЦДФЭ => Базы данных => Параметры основных состояний атомных ядер

... Department of History of Foreign Literatures, Lomonosov State University of Moscow (MGU) . About the department . ... Department history . ... About the department / Lectors . ... Chairman, Ph.D., Professor . ... Ph.D. , Associate-Professorљ . ... Ph.D. , Professor . Aleksandra Yuryevna Zinovyeva . ... Ph.D. ,љSenior Researcher . ... Ph.D. , Researcher . ... Ph.D. , Assistant-Professor . ... Olga Yuryevna Panova . ... Irina Yuryevna Popova . ...

Еще в разделе: (Показать все результаты (>3) - forlit.philol.msu.ru/ )

... 2013 . ... Staff . ... 2006 2010: Head of the Department of Information Technologies and Computer Engineering of the Department Т?Mechatronic systemsТЛ at ISTU. since 2013: Associate Professor of the Department of Theoretical Physics at Udmurt State University; Associate Professor of the Department Т?Higher mathematicsТЛ at M.T. Kalashnikov Izhevsk State Technical University. since 2013: Junior Researcher of the Laboratory of Nonlinear Analysis and the Design of New Types of Vehicles at UdSU. ...

Еще в разделе: (Показать все результаты (>93) - ics.org.ru/ )

• Institute of Computer Sciences - Staff - Ivanova Tatyana Borisovna
• Institute of Computer Sciences - Staff - Kilin Alexander Alexandrovich
• Institute of Computer Sciences - Staff

... Leading Research Associate (MSU) . ... Graduated from the Moscow State University, 1960 . PhD, Moscow State University, 1970 . Doctor of Sciences, Moscow State University, 1995 . ... Type of Research: experiment . Research Interests: . ... Graduated from the Moscow Institute of Chemical Technology, 1954 . PhD, Moscow Institute of Chemical Technology, 1958 . Doctor of Sciences, Moscow Institute of Chemical Technology, 1981 . ... Type of Research: experiment, theory . ...

Еще в разделе: (Показать все результаты (>2) - newcryst.phys.msu.ru/ )

" " Dr. Oleg Semenikhin, Associate Professor, Department of Chemistry, The University of Western Ontario, Canada 1. . , . : (1) . . (2) . . . . 2. . - -. . -. . 3. . - . . - . . 4. . , -. . 5. . . 6. , . , . . 7-8. . . . (dye-sensitized solar cells). - . , CuInSe. . . 9. . . . : 1. . , .. . . ., , 1983. 2. ( ). , .

Еще в разделе: (Показать все результаты (>5) - nano.msu.ru/ )

List of Publications Elena A. Kudryavtseva March 2007 1. Gerver, M. L. and Kudryavtseva, E. A. (1995): A theorem on precedence relations generated by completely positive kernels. ... Russian Math. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2001): Intersection index of curves on surfaces and applications to quadratic equations in free groups. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2002): Ro ots of mappings on nonorientable surfaces and equations in free groups. ...

Еще в разделе: (Показать все результаты (>97) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/papers-sym/brahana.pdf
• http://dfgm.math.msu.su/files/papers-sym/reg%20maps%20nonorientable%20surfaces.pdf
• http://dfgm.math.msu.su/files/koudr/publ3eng.pdf

РАСПРЕДЕЛЕНИЕ ИНЕРЦИОННОЙ ПРИМЕСИ В ТЕЧЕНИИ СУСПЕНЗИИ И ЗАПЫЛЕННОГО ГАЗА В ПОГРАНИЧНОМ СЛОЕ НА ПЛАСТИНЕ О.Д. Рыбдылова, А.Н. Осипцов Институт механики МГУ им. М.В. Ломоносова, Москва Рассматриваются две модели течений дисперсных сред в пограничном слое на плоской пластине в поле силы тяжести. ... Исследованы два случая: течение запыленного газа вдоль вертикальной пластины и течение суспензии вдоль горизонтальной пластины. ... вправо для первой и вниз для |запыленного газа у|суспензии вдоль | ...

Еще в разделе: (Показать все результаты (>60) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2012/abstracts/nez.doc
• http://hit-conf.imec.msu.ru/2012/abstracts/tezis_chulyunin_reshmin.doc

... В рамках статьи рассматривается процесс формирования и исполнения бюджета субъекта РФ (на примере Ульяновской области) с позиций ex-ante и ex-post: выделенные хронологические точки среза параметров бюджета (исходная и окончательная редакция регионального закона о бюджете) сопоставляются с отчетом об исполнении. ... Бюджетное планирование, региональный бюджет, исполнение бюджета, ex-ante, ex-post. ...

Еще в разделе: (Показать все результаты (>43) - e-journal.spa.msu.ru/ )

pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological ... Teaching and learning a foreign language at a distance. ...

Еще в разделе: (Показать все результаты (>4) - dist.ffl.msu.ru/ )

• Факультет иностранных языков и регионоведения МГУ. Центр дистанционного
• Факультет иностранных языков МГУ. Центр дистанционного обучения.

HOMEPAGES OF MUSCLE PEOPLE or GROUPS AROUND THE WORLD . ... King's College, London . Michael Ferenczi . Imperial College of Science, Technology & Medicine, London . ... Michael Reedy . ... London Muscle Series . ... European Biophysical Societies' Association . European Society for Muscle Research . ... Argonne National Laboratory, USA  . ... Daresbury Laboratory, UK . MUSCLE-RELATED PERIODICALS . Biophysical Journal . ... The Journal of Physiology . ...

Еще в разделе: (Показать все результаты (>2) - muscle.imec.msu.ru/ )

CUDA Center of Excellence NVIDIA 22 « » ­ NVIDIA HPC Day. NVIDIA, , . Wen-mei W. Hwu (), , . 9:30 -- 10:00 10:00 -- 11:30 The Future of GPU computing Prof. Wen-mei W. Hwu 11:30 -- 12:00 Introducing Kepler: new generation GPU architecture Mark Ebersole , , 12:20 -- 13:20 , .. , .. , .. , .. 13:20 -- 15:00 GPU CUDA Prof. Wen-mei W. Hwu - « » : 2- , . 238 : http://ccoe.msu.ru

Еще в разделе: (Показать все результаты (>7) - ccoe.msu.ru/ )

• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

ChangeLog for tanchiki # # Generated by Trac 0.12.5 # 04/11/16 23:02:23 Mon, 20 Dec 2010 05:15:19 GMT Peter Zotov <whitequark@тАж> [21:fe5df803d6c2] * tanchiki/body.py (modified) * tanchiki/controller.py (added) * tanchiki/game.py (modified) * tanchiki/user_controller.py (added) Split UserController and Controller classes. Mon, 20 Dec 2010 05:08:18 GMT Peter Zotov <whitequark@тАж> [20:ee776b889df7] * tanchiki/game.py (modified) Improve Game interface. ...

Еще в разделе: (Показать все результаты (>1388) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=99%3A33fea6b97cd3&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=b3fb9595fee7ccf4db04b4f448092fa94188ed82&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=33fea6b97cd34ca033da0bd43c72c37ae5967579&limit=100&mode=stop_on_copy

... Input parameters Key parameters: - sqrt(s), GeV N events ­ total number of events A number of target/projectile B min, B max ­ impact parameters (in fm) for all events Choice of parton-hadron conversion scenario (AMPT model, AMPT with string and others) Parameters for Lund fragmentation Quenching flag (on\off) K short decay flag, other flags Output parameters Output file: ampt.dat, containts: Event number Impact parmeter Total number of participants n. in proj. ...

Еще в разделе: (Показать все результаты (>41) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~igor/seminar/Hydjet_status_2013.pdf
• http://lav01.sinp.msu.ru/~igor/seminar/1108.0717_AMPT_Xu_Ko.pdf

... О проекте . ... A specialized source of quasi-?monochromatic X-?ray radiation for medical application is proposed. It includes two electron storage rings (E = 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. Hard X rays are generated in a process of back Compton scattering of laser photons ~1eV by electrons in the linear paths of storage rings. ...

Еще в разделе: (Показать все результаты (>8) - miles.sinp.msu.ru/ )

• Пространственное распределение интенсивности излучения диодных линеек с
• Proposal of a Compact Repetitive Dichromatic X-ray Generator with Millisecond

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

Home People Activities Research Publications . ... Containers for image storage in memory, reading and writing of image files, Pipeline filtering library, D.Yurin "On the Images Pipe Line Filtering, PDF , color spaces, fast convolutions, image registration algorithms, edge curvature estimation via differential invariants (under development) , Bresenham algorithms, some numerical algorithms etc. ... Download help on project (CHM) , generated via doxygen (see How to document program's code ) . ...

Еще в разделе: (Показать все результаты (>10) - imaging.cs.msu.ru/ )