In general, homing endonucleases are meganucleases (i.e. they recognise and cut DNA sequences longer than 12 bp) encoded in various intervening sequences. ... Here we investigate the diversity of yeast intein-encoded LAGLIDADG endonucleases, and annotate their particular residues in terms of importance for DNA recognition, binding and cleavage. PFAM family PF05204 contains sequences of most of the yeast intein-encoded LAGLIDADG endonucleases. ...

Еще в разделе: (Показать все результаты (>42) - monkey.belozersky.msu.ru/ )

• HF clusters: algorithm
• ETS_hydrophobic_interactions
• HTH3_hydrophobic_interactions

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>9) - hcs.cmc.msu.ru/ )

• Master program "Information Security and Cryptography" | Магистерское и

... Registration and Abstract submission are open for the International Conference on Physics Education ICPE 2014 , that will take place at the Sheraton Cordoba Hotel & Convention Center, C rdoba, Argentina, on August 18th to 22th, 2014. ... Keynote Speaker: Cedric Linder , Professor of Physics Education Research, Division of Physics Education Research, Department of Physics and Astronomy, Uppsala University, Sweden. ... Prof. Zulma Gangoso (Chair) . ... Prof. Zulma Gangoso (Argentina) . ...

Еще в разделе: (Показать все результаты (>22) - foroff.phys.msu.ru/ )

• Postdoctoral training (General Physics and Wave Processes)
• Postdoctoral training (Cosmic Rays and Physics of Space)
• Postdoctoral training of foreign scientists at Physical Department

... Men'shov I.S., Strong blast wave propagation in disperse mixture, Dokl. ... Men'shov I.S., Propagation of shock and detonation waves in dust-laden gases, Izvest. ... Men'shov I.S., Nakamura Y., Numerical Simulation of Nonequilibrium Air Flow over Spheres, in: Proc.27th Fluid Dynamics Conf., ... T. Saito, T. Nakamura, I. Men'shov, Y. Nakamura, Numerical Investigation of Ignition Overpressure Caused by Rocket Plume, Proceedings of the 35th Japan Fluid Dynamics Conference, Kyoto, Sep. 2003, pp. ...

Еще в разделе: (Показать все результаты (>7) - compmech.math.msu.su/ )

• http://compmech.math.msu.su/publ/parallel_time.pdf
• Список публикаций - А. Н. Козлова - Кафедра вычислительной механики

... Moscow State University, Moscow, 119899 Russia . Abstract - Calix[8]arene ethers, carboxylic esters having various p-substituents and acid are synthesized and studied. In a bulk membrane transport of dodecylpyridinium the better carrier is the simplest host, calix[8]arene octamethyl ether. ... Various calixarenes are successfully used in plasticized membrane ion-selective electrodes (ISE) for both above ammonium and pyridinium surfactants. ...

Еще в разделе: (Показать все результаты (>32) - analyt.chem.msu.ru/ )

• The Molecular Mechanic Approach to Coordination Compounds: Force Field Based on
• Study of amino- and pyridyl-containing zinc(II) and cadmium(II) complexes by
• Molecular Mechanics Calculations of beta-Diketonate, Aqua, And

CUDA Center of Excellence NVIDIA 22 « » ­ NVIDIA HPC Day. NVIDIA, , . Wen-mei W. Hwu (), , . 9:30 -- 10:00 10:00 -- 11:30 The Future of GPU computing Prof. Wen-mei W. Hwu 11:30 -- 12:00 Introducing Kepler: new generation GPU architecture Mark Ebersole , , 12:20 -- 13:20 , .. , .. , .. , .. 13:20 -- 15:00 GPU CUDA Prof. Wen-mei W. Hwu - « » : 2- , . 238 : http://ccoe.msu.ru

Еще в разделе: (Показать все результаты (>5) - ccoe.msu.ru/ )

• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

Converters . A converter from ASCI GRD (Surfer, Golden Software Inc.) files into IPI data format. A converter from Res2dInv and IRIS SysCal files (Windows) . ... Runtime Error 200 - 'Divide by 0' on fast PCs. ... The cause of this error is a bug of Borland Pascal 7 . Now we found the way to solve this problem (on page "Fix for Borland Pascal" ). ... 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics, Bobachev Alexei . ...

Еще в разделе: (Показать все результаты (>50) - geophys.geol.msu.ru/ )

ChangeLog for tanchiki # # Generated by Trac 0.12.5 # 04/11/16 23:02:23 Mon, 20 Dec 2010 05:15:19 GMT Peter Zotov <whitequark@тАж> [21:fe5df803d6c2] * tanchiki/body.py (modified) * tanchiki/controller.py (added) * tanchiki/game.py (modified) * tanchiki/user_controller.py (added) Split UserController and Controller classes. Mon, 20 Dec 2010 05:08:18 GMT Peter Zotov <whitequark@тАж> [20:ee776b889df7] * tanchiki/game.py (modified) Improve Game interface. ...

Еще в разделе: (Показать все результаты (>1390) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=99%3A33fea6b97cd3&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=b3fb9595fee7ccf4db04b4f448092fa94188ed82&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=0865e29e319df9486ce64a2b5e28808a54c6ca12&stop_rev=33fea6b97cd34ca033da0bd43c72c37ae5967579&limit=100&mode=stop_on_copy

... opt/atlas/12.0.8/cmtsite/setup.sh -tag=<release>[,<mode>] # # projects # . opt / atlas / 12.0.8 / cmtsite /setup.sh -tag= project , release [, mode ] # # Report bugs to hn- atlas -releaseKitProblem@cern.ch , atlas -sw-installation@cern.ch . # set CMTSITE STANDALONE set SITEROOT / opt / atlas / 12.0.8 macro ATLAS_DIST_AREA ${ SITEROOT } # use optimised version by default apply_tag opt apply_tag setup apply_tag projectArea ...

Еще в разделе: (Показать все результаты (>4) - lhe.sinp.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... This applet generates an observing list based on an observer's location and time. ... To use this program, enter in your location, and the local times at which you wish to begin and end observing. The date you enter should correspond to the calendar day at the time at which you begin observing. For example, if you wish to observe from 9:37 PM October 23, 2007 until 3:21 AM October 24, 2007, you would enter 21:37 for the starting time, 03:21 for the finish time, and 10/23/2007 for the date. ...

Еще в разделе: (Показать все результаты (>24) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ­ velocity potential, H ­ depth, ­ vector of bottom deformation, 0 ­ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>14) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/pubs/Chashechkin-Waves.pdf
• http://ocean.phys.msu.ru/conf/fsf2009/programme.pdf
• http://ocean.phys.msu.ru/science/nosov/EGU2010_pumping.pdf

MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer ­ Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...

94. Publications

95. http://library.biophys.msu.ru/PDF/3347.pdf

96. http://www.botsad.msu.ru/docs/eng_iris1.doc

97. http://num-anal.srcc.msu.su/eng_math/redict/25.htm

98. http://dist.ffl.msu.ru/cdo/conf0606/regfeng.doc

99. Department of General Physics and magneto-ordered matter. Physics Faculty of

100. staff:guterman:teach_engl.html | Кафедра высшей алгебры