... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>7) - edas2.bioinf.fbb.msu.ru/ )

• Alternative Splicing DataBase.
• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>2) - npidb.belozersky.msu.ru/ )

... This is a bug fix release for the 3.x series of Joomla. ... Project and the Production Leadership Team are proud to announce the release of Joomla! 3.5 as the latest in the 3.x series. ... CMS 3.5 Release Candidate 4 . ... CMS, with 3.5 the sixth standard-term support release in this series. ... That being said, please do not upgrade any of your production sites to the release candidate version as a release candidate is ONLY intended for testing and there is no upgrade path from a Release Candidate....

Еще в разделе: (Показать все результаты (>2) - biophys.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• ConClus

HERMITE FUNCTIONS EXPANSION BASED NON-LOCAL MEANS ALGORITHM FOR CT-APPLICATIONS1 N. Mamaev2, A. Lukin3, D. Yurin4, M. Glazkova5, V. Sinitsin6 Laboratory of Mathematical Methods of Image Processing Faculty of Computational Mathematics and Cybernetics Lomonosov Moscow State University Leninskie Gory, Moscow 119991, Russia mamaev.nikolay93@mail.ru, 3lukin@ixbt.com, 4yurin@cs.msu.ru 5,6 Federal Center of Medicine and Rehabilitation Ivan'kovskoye sh., ... Noise in CT-images is close to Gaussian [3]. ...

Еще в разделе: (Показать все результаты (>8) - imaging.cs.msu.ru/ )

... Главная . ... Контакты . ... Ленинские горы, дом 1, строение 12 . Москва, почтовый индекс 119991 . ... Телефон: +7(495) 987 65 21 . Факс: +7(495) 987 65 21 . ... Ленинские горы, дом 1, . ... 7 (495) 939-10-00 . ...

Еще в разделе: (Показать все результаты (>2) - depository.msu.ru/ )

... A new image object format suggested. ... DataPtr ­ pointer to image data row. ... Collections.Generic; System.Windows.Forms; Microsoft.JScript; Microsoft.JScript.Vsa; Microsoft.Vsa; } return result; // Reading script from file public static string ReadScriptFromFile( string fileName) { System.IO.StreamReader sr = new System.IO.StreamReader(fileName); string sScript = ; try { sScript = sr.ReadToEnd(); } catch (Exception ex) { //TODO } finally { sr.Close(); } } return sScript ...

Еще в разделе: (Показать все результаты (>97) - imaging.cmc.msu.ru/ )

• Ringing analysis - database | Laboratory of Mathematical Methods of Image
• View publication | Laboratory of Mathematical Methods of Image Processing

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Octotron: Active Control for Reliable Functioning of Supercomputers . ... Detection of all damage/failure sources which may occur within supercomputer or data center; . ... Key feature of the Octotron system is representing the supercomputer functioning model in the form of expanded multi-graph. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Excursions to Supercomputing Center . ...

Еще в разделе: (Показать все результаты (>26) - hpc.msu.ru/ )

• Octoshell: Lightweight and Innovative Cluster Management System | Moscow
• JOINT MSU-INTEL CENTER ON HIGH PERFORMANCE COMPUTING | Moscow University
• Distributed Modular Monitoring System: a New Approach to Supercomputer

. Помощь - Поиск - Пользователи - Календарь . Полная версия: Пост прозрения . Грация-МГУ::Форум > Общение > Общение . O'Rey . Dec 21 2009, 01:49 . Эппл открывает нам глаза: . http://support.apple.com/kb/HT2300 . Это текстовая версия - только основной контент. Для просмотра полной версии этой страницы, пожалуйста, нажмите сюда .

Еще в разделе: (Показать все результаты (>3) - grace.msu.ru/ )

• Пост прозрения - Грация-МГУ::Форум

... Geography of World Economy . ... Recreational Geography and International Tourism . ... World Data Systems functions under the sponsorship of the International Council for Science ICSU since 1956 (until 2008 in the form of two structures - World Data Centers and the Federation of Astronomical and Geophysical Data Analysis Services). ... Map "The population of the Russian Federation", scale 1:7 500 000, Russian Geographical Society, Faculty of Geography Moscow State University, OOO "FOC", 2014. ...

Еще в разделе: (Показать все результаты (>31) - eng.geogr.msu.ru/ )

• Undergraduate study
• Satino teaching and research station
• Department of Cartography and Geoinformatics

... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...

Еще в разделе: (Показать все результаты (>2) - ccoe.msu.ru/ )

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>3) - apollo.sai.msu.ru/ )

• Dome Kislovodsk Database ::
• Astelco Kislovodsk Database ::

... http://www.univ-lorraine.fr/ . We have long-time collaboration with scientists from Laboratoire de Physique Moleculaire et des Collisions, Institut de Chimie, Physique et des Materiaux. 14 joint papers were published so far. ... http://www.uclouvain.be/ . ... There were published about 10 joint papers on mathematical aspects of few-body scattering theory in the case of Coulomb potentials. ... http://www.phys.msu.ru/ . ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>5) - lmmqsp.sinp.msu.ru/ )

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey