Chlorophyll Fluorescence in vivo : A Theory (Part I) . Most part of the photosynthetic pigments in phytoplankton cell reside in peripheral pigment-protein complexes of the light-harvesting antenna (I, see Fig. ... From peripheral antenna complexes, excitation is efficiently transferred to core antenna complexes near photosynthetic reaction centers (II, Fig. 1), where it can be used in the primary photochemical reaction of photosynthesis. ... and phytoplankton concentration . ...

Еще в разделе: (Показать все результаты (>20) - www.biophys.msu.ru/ )

• (Chlorophyll Fluorescence in vivo: A Theory
• MEASURING THE PHYTOPLANKTON PHOTOSYNTHESIS RATE USING A PUMP-AND-PROBE

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Рейтинг: 24 . Вопросы по VirtualDub. ... Рейтинг: 3392 . Re: Вопросы по VirtualDub. [ re: Sam ] . 08.01.2003 01:08 . ... Re: Вопросы по VirtualDub. [ re: Xenon ] . ...

Еще в разделе: (Показать все результаты (>1725) - www.fds-net.ru/ )

• Детализация рейтинга: filter - Public forum of MSU united student networks
• lowpass Butterworth filter - Public forum of MSU united student networks
• SALE! TV, washer, coffee-machine, water filter !!! - Public forum of MSU united

... Spectral and kinetic parameters of phosphorescence of triplet chlorophyll a in the photosynthetic apparatus of plants. ... Spectral and kinetic parameters and quantum yield of IR phosphorescence accompanying radiative deactivation of the chlorophyll a (Chl a) triplet state were compared in pigment solutions, greening and mature plant leaves, isolated chloroplasts, and thalluses of macrophytic marine algae. ... This parameter is stable in leaves of different plant species. ...

Еще в разделе: (Показать все результаты (>72) - biochem.bio.msu.ru/ )

• Human pro-B-type natriuretic peptide is processed in the circulation in a rat
• Processing of pro-brain natriuretic peptide is suppressed by O-glycosylation in
• Processing of pro-B-type natriuretic peptide: furin and corin as candidate

... Phone: (007) 095-9395197; fax: (007) 095-9395888; e-mail: e@lav01.sinp.msu.ru . ... The term of training - 1-2 years. ... Physics of quark-gluon mesons spectroscopy? ... Scientific chief - Ludmila Ivanovna Sarycheva, professor of the Chair of Cosmic Rays and Physics of Cosmos and leader of Laboratory of Hadron Interactions of SINP MSU senior science researcher, PhD. ... Simultaneously the problem of the solar cosmic ray flare energetic electron sources in the interplanetary space will be studied. ...

Еще в разделе: (Показать все результаты (>32) - foroff.phys.msu.ru/ )

• Postdoctoral training (General Physics and Wave Processes)
• Postdoctoral training of foreign scientists at Physical Department
• Postdoctoral training (Neutronography)

... 26-Sep-2011 12:35 . ... 22K . ... 12K . ... filters-artistic-applycanvas.png . ... filters-artistic-cubism.png . ... filters-artistic-oilify.png . ... filters-blur-gaussselect.png . ... filters-blur-mblur.png . ... filters-blur-pixelize.png . ... filters-blur-tileable.png . ... filters-color-borderaverage.png . ... filters-color-colorify.png . ... filters-color-filterpack.png . ... filters-color-hot.png . ... filters-color-maxRGB.png . ... filters-dilate-image.png . ... 21K . ... 57K . ...

Еще в разделе: (Показать все результаты (>221) - uneex.mithril.cs.msu.su/ )

• HelpOnMoinCommand/ExportDump - UNИX
• Index of /static/GimpDoc_EnRu/images/filters/es
• HelpOnXapian - UNИX

... Parameters . ... Natural Satellites Data Center. Parameters and constants . ... Satellites of Mars . Satellites of Jupiter . Satellites of Saturn . Satellites of Uranus . Satellites of Neptune . Satellite of Pluton . Masses of satellites . Dimensions of satellites . Photometric parameters of satellites . Rotational parameters and poles . Orbital parameters of the outer satellites of Jupiter, Saturn, Uranus and Neptune . ...

Еще в разделе: (Показать все результаты (>23) - www.sai.msu.ru/ )

... OCEAN ACOUSTICS. ... It is proposed to use high frequency resolution methods of sonographic analysis (spectral­ time representation) of projections of the acoustic power flux vector for spatial resolution of sources that pro vide a higher signal to noise level at the output of the processing system. ... The problem of obtaining an acoustic image is extremely difficult, since the required spatial source resolution at low frequencies is usually several times smaller than the acoustic wavelength. ...

Еще в разделе: (Показать все результаты (>55) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/gusev_files/nano2.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

100. http://www.eng.math.msu.su/download/Midterm_test.pdf