... Executing config_lcgenv Executing config_java Executing config_ glite _tar_ui gLite Security Utilities configuration successfully completed xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Configuring the gLite R-GMA Client xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Checking configuration values [ OK ] Verifying the / gLite / glite / etc ... Configuring BDII based Service Discovery [ OK ] Configuring R-GMA based Service Discovery .. ...

Еще в разделе: (Показать все результаты (>8) - lhe.sinp.msu.ru/ )

... Форумы > Аспирантура > Тема . ... Аспирантура в Порту, Португалия . ... Grant call on E-Careers site: . ... Research Grant . ... Position/ Grant: PhD Research Grant. Generic scientific area: Engineering. ... Location: University of Porto, Faculty of Engineering, Department of Informatics Engineering (FEUP-DEI), http://www.fe.up.pt . ... This PhD research grant requires the completion of a PhD at the Department of Informatics Engineering, Faculty of Engineering, University of Porto (FEUP-DEI). ...

Еще в разделе: (Показать все результаты (>121) - www.mmonline.ru/ )

• Програма конферецнии Topology, analysis and applications in mathematical
• MMOnline | Новости | Програма конферецнии Topology, analysis and applications
• MMOnline | Форумы | Первокурсникам | Си - полезная информация

... CRITICAL REMARKS ON THE USE OF MEDIEVAL ECLIPSE RECORDS FOR THE DETERMINATION OF LONG-TERM CHANGES IN THE EARTH'S ROTATION . ... The use of some Arabic medieval solar and lunar eclipse records for the determination of secular changes in the Earth's rotation is critically reviewed. ... Up to this day there is no better approach for the determination of long-term (or secular) changes in the Earth's rotation than the evaluation of medieval and ancient observational records of solar and lunar eclipses. ...

Еще в разделе: (Показать все результаты (>125) - hbar.phys.msu.ru/ )

• Age Determinations by Radiocarbon Content: Checks with Samples of Known Age
• The jump of the second derivative of the moon's elongation
• newtrev2.htm

... I. Bogdanova, R. F. Galeevb, S. P. Kulikb, and E. V. Morevac a Institute of Physics and Technology, Russian Academy of Sciences, Moscow, 117218 Russia b Faculty of Physics, Moscow State University, Moscow, 119992 Russia c Moscow Engineering Physics Institute (State University), Moscow, 115409 Russia Received October 12, 2006 Abstract--A model that approximately takes into account instrumental errors in problems of precision reconstruction of quantum states is considered. ...

Еще в разделе: (Показать все результаты (>87) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/papers/2013-njp-15-035012.pdf
• http://qi.phys.msu.ru/kulik/Papers/PRA42303.pdf
• http://qi.phys.msu.su/papers/2005-jetpl(e)-82-164.pdf

... О UNИX . ... Authenticating against Windows-Domain using SSPI . ... Apache 2.0.xx. ... These instructions assume you've successfully set up a working moin configuration (based on HelpOnInstalling/ApacheOnWin32 ) and you're expanding to include Domain Authentication. a Domain Controller . ... Configuring Apache http.conf file . ... Domain Authentication using mod_auth_sspi.so from MoinMoin.auth.http import http from MoinMoin.auth import moin_session auth = [http, moin_session] user_autocreate = True ...

Еще в разделе: (Показать все результаты (>66) - uneex.mithril.cs.msu.su/ )

Еще в разделе: (Показать все результаты (>58) - dfgm.math.msu.su/ )

• 1st Announcement

Firefly (previously known as the PC GAMESS) is a freely available ab initio and DFT computational chemistry program developed to offer high performance on Intel-compatible x86, AMD64, and EM64T processors. ... At moment, Firefly includes no more than 5% of the legacy code. ... Firefly is freely available for all main PC operating systems: Windows, Linux, and Mac OS X. Firefly supports various Windows versions including Windows 8, Windows 7, Windows Server 2008, Vista, 2003, XP, 2000, NT, and 98/Me. ...

Еще в разделе: (Показать все результаты (>72) - classic.chem.msu.su/ )

• Firefly DOCUMENTATION - command line arguments
• PC GAMESS version 7.1 to version 7.1.5 update information
• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2

... UHECR SINP MSU . ... News . ... Publications . ... Multiple observations of Blue Jets (BJ)) show that BJ emits a fan of streamers similar to a laboratory leader. ... It was also noticed that BJ are similar to the streamer zone of a leader (streamer corona) and the modeling studies based on the streamers fractal structure were conducted. ... This similarity analysis has been done in three steps: First we described the dendritic structure of streamers in corona discharge applying the fractal theory. ...

Еще в разделе: (Показать все результаты (>16) - uhecr.sinp.msu.ru/ )

• UHECR news
• Новости КЛПВЭ

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

EQUIVALENT DIPOLES APPROACH TO THE ELECTRICAL FIELD VECTOR MEASUREMENTS DATA INTERPRETING Aleksandr A. Gorbunov, Igor. ... Generalizing the traditional apparent resistivity [pic] for the pole- dipole (half-Schlumberger) array, the apparent resistivity vector [pic] with components [pic] is introduced. ... Considering the layered cross-section as the embedding medium, apparent resistivity vector can be presented as [pic] - the sum of the normal and the anomalous apparent resistivity. ...

Еще в разделе: (Показать все результаты (>74) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/shevnin/publ/160.pdf
• http://geophys.geol.msu.ru/shevnin/publ/159.pdf
• http://geophys.geol.msu.ru/shevnin/publ/174.pdf

Academic English Part 4 of 4 Sources: 1. ... Cambridge University Press Unit After · · 51 completing the tasks the students will: Learn about US system for higher education in science Learn some communicative strategies they might use when asking for help or information from colleagues · Learn to write a CV and participate in an interview · Revise their reading strategies · Revise their summarizing strategies Camb 1. 2. 3. 4. ridge English for Scientists, Unit 1, pp.6-7 all ...

Еще в разделе: (Показать все результаты (>21) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Model_rendering_scheme_and_connectives.pdf

... J.K. Krylov . In the monography by R. Koehler [1] there was described a very interesting effect of the words' average length oscillation as a function of their frequency of use (according to the data from a representative frequency dictionary). ... In this context, further the Koehler's effect will be definied as polymodal character of the dependence of the conditioned average in cases of two-dimencional distributions of any linguistic nature. ...

Еще в разделе: (Показать все результаты (>65) - old.philol.msu.ru/ )

• MSU-LGCLL:: DicTUM-1 - A System for Dictionary-Text Universal Manipulations and
• MSU-LGCLL:: Anatoliy A. Polikarpov - Some Factors and Regularities of
• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>308) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/ongoing_projects.html

.

95. http://nanolab.phys.msu.ru/sites/default/files/paper_hybrid.pdf

96. CONTENTS ? 6 - 2012

97. Stopping and Restarting Apache

98. http://chaos.phys.msu.ru/loskutov/PDF/IJBC_3body_problem.pdf

99. Master programљ"Decision Engineering in Economics and Finance" | Магистерское и

100. http://scan.sai.msu.ru/lk/