In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>8) - bioinf.fbb.msu.ru/ )

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>52) - www.kosmofizika.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>220) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: ЮНЕСКО обвинили в поддержке псевдонауки нобелевского
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали
• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс

... In the small-x approximation: u u = x p (neglecting also the quark masses) p A.V . Lipatov QFTHEP 2010 , Golitsyno , Russia , September 10, 2010 Calculations III KMR unintegrated PDFs M.A. Kimber, A.D. Martin, M.G. Ryskin, PRD 63, 114027 (2001) 2 f q x , k 2 , 2 ~T q k 2 , 2 [ Pqq вq x , k T P ... Kutak, DIS'08 sea quark density is approximated by the last gluon splitting, i.e. f s q 2 x , k 2 , 2 ~ P qg в f g x , k T , 2 T A.V ...

Еще в разделе: (Показать все результаты (>151) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/Bunichev_singletop_tWb_LHC.pdf
• http://qfthep.sinp.msu.ru/talks2013/Bunichev_QFTHEP2013.pdf
• http://qfthep.sinp.msu.ru/talks2011/asymbrane_QFTHEP11.pdf

International Laser Center of MSU . Home . ... Education . ... Grants . ... 06.10.2014 . October 10, 2014 . 15:00 S.A. Akhmanov Hall, KNO . ... 20.09.2009 . 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . Moscow Vyatichi, November 9 - 11, 2009. ... March 21, 2014 . 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home Research Grants . ... Russian Ministry of Science and Education . ... 2009 ILC MSU Made in: Sebekon IT Solutions . ...

Еще в разделе: (Показать все результаты (>77) - ilc.phys.msu.ru/ )

... Symmetry in Bubble Dynamics . ... An investigation on novel lines is made into the problem of nonlinear bubble dynamics. ... The complete symmetry groups are found for the Rayleigh equation. ... The possible application of the scaling law dynamics to the problem of stable single bubble sonoluminescence is discussed. Conformal symmetry of Laplace equation provides an approach for finding exact solutions for the pulsation of gas bubble tethered to a rigid wall. ...

Еще в разделе: (Показать все результаты (>103) - acs366.phys.msu.su/ )

• General Information

... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...

Еще в разделе: (Показать все результаты (>3) - www.students.chemport.ru/ )

... Guidelines for Paper Submission . ... The program committee will schedule both oral and poster sessions. The abstract and summary of both oral and poster papers are published in the same manner in the Conference Program and the Technical Digest on CD-ROM. ... Oral Sessions . ... Poster Sessions . ... For poster sessions, authors are provided with bulletin boards on which to display their papers, along with a sign indicating their paper numbers, and pushтАУpins or adhesive tape. ... Program . ...

Еще в разделе: (Показать все результаты (>6) - iconolat13.phys.msu.ru/ )

... Academic Programmes . ... Vestnik CIE (in Russian) . FAQs (in Russian) . ... About Moscow University . Links (in russian) . ... Test Your Russian ? ... Lomonosov Moscow State University . ... Day- -Month- -Year- . ... Choose- Male Female . ... Choose- -Other- . ... Russian language for academic purposes major subjects) . Course: . ... Choose- during academic year summer courses . ... Course dates: . ... Choose- professional training refresher course brief refresher course traineeship . ...

Еще в разделе: (Показать все результаты (>16) - www.cie.ru/ )

• Russian Language Programmes :: Academic Programmes :: CIE
• Documents Confirming Academic Background :: Admissions :: CIE

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>7) - www.issp.ac.ru/ )

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>173) - www.philol.msu.ru/ )

• Conference to commemorate A.E. Kibrik :: МГУ :: Филфак :: ОТиПЛ

pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological ... Teaching and learning a foreign language at a distance. ...

Еще в разделе: (Показать все результаты (>2) - dist.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр дистанционного обучения.

... Научно-методический совет по иностранным языкам . ... Факультет иностранных языков и регионоведения . МГУ им. М.В. Ломоносова. Центр Дистанционного Образования . ... The Scientific and Methodological Council on Foreign Language Teaching . ... в обучении иностранным языкам и межкультурной коммуникации", . которая состоится 7-8 июня 2006 г. на базе . факультета иностранных языков и регионоведения . ... Дидактические принципы дистанционного обучения иностранным языкам; . ...

Еще в разделе: (Показать все результаты (>4) - anazarenko.ffl.msu.ru/ )

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>34) - erg.biophys.msu.ru/ )

• comcon1 ERG Research Group: Лаборатория теоретической биофизики

... A p P EC Astropar ticle Physics for Europe · Cosmic rays: A large array for the detection of charged cosmic rays ( Auger North) · Gamma rays: A large array of Cherenkov Telescopes for detection of cosmic high energy gamma-rays ( CTA ) · High energy neutrinos: A cubic kilometre-scale neutrino telescope in the Mediterranean (KM3NeT) · Dark matter search: Ton-scale detectors ... A p P EC Astropar ticle Physics for Europe · Cosmic rays: ­ ­ ­ ­ ­ AMS detector launched. ...

Еще в разделе: (Показать все результаты (>5) - tunka.sinp.msu.ru/ )

... B Design and developmentof a new vacuum chamber for the tests of Q-factors in suspension's modes . ... E New SQL free principle of coordinate monitoring of the test mass . F Appendix I . ... The achieved p new resolution 2 10;11cm= Hz was su cient to record Brownian vibration with relative accuracy better than 10% (see details in Appendix I). ... See details in Appendix IV) E. New SQL free principle of coordinate monitoring of the test mass The new concept of quantum measurement | ...

Еще в разделе: (Показать все результаты (>77) - hbar.phys.msu.ru/ )

• http://hbar.phys.msu.ru/gorm/ahist/antikythera2.pdf
• http://hbar.phys.msu.ru/gorm/fomenko/fomenko2.pdf
• Age Determinations by Radiocarbon Content: Checks with Samples of Known Age

... 1) For our previous attempts to analyse possible mechanism of analytisation or, on the contrary, synthetisation of language structure (including vocabulary) see [Polikarpov 1976; 1979]. 2) For a more detailed analysis of these data see [Polikarpov, 1999; Polikarpov a.o., 1999]. ... For more information see [Polikarpov a.o., 1999]. 5) For more details on a "pure" unit of lexical system (called hyperlexeme) see [Boroda, Polikarpov, 1988; Karimova 1989; Karimova, Polikarpov, 1989]. ...

Еще в разделе: (Показать все результаты (>46) - old.philol.msu.ru/ )

• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics

... Форумы > Аспирантура > Тема . ... Аспирантура в Порту, Португалия . ... Grant call on E-Careers site: . ... Research Grant . ... Position/ Grant: PhD Research Grant. Generic scientific area: Engineering. ... Location: University of Porto, Faculty of Engineering, Department of Informatics Engineering (FEUP-DEI), http://www.fe.up.pt . ... This PhD research grant requires the completion of a PhD at the Department of Informatics Engineering, Faculty of Engineering, University of Porto (FEUP-DEI). ...

Еще в разделе: (Показать все результаты (>81) - www.mmonline.ru/ )

• MMOnline | Форумы | Книжная барахолка | Продам книги по программированию
• MMOnline | Форумы | Книжная барахолка | Продам: Учебники по английскому
• MMOnline | Форумы | Первокурсникам | Си - полезная информация

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ THE NEW GRIDDED KURIL-KAMCHATKA BATHYMETRY FOR TSUNAMI MODELING An. ... For calculations in each grid point where the depth is to be found the algorithm uses up to 9 points from data source. ... Then the spline interpolation is used for defining the depth value in the grid-point. ... Hydrographic Survey Data, CD-ROM data set, Ver. ...

Еще в разделе: (Показать все результаты (>21) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E06_Gusiakov.pdf