In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>8) - bioinf.fbb.msu.ru/ )

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>52) - www.kosmofizika.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>220) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: ЮНЕСКО обвинили в поддержке псевдонауки нобелевского
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали
• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс

... In the small-x approximation: u u = x p (neglecting also the quark masses) p A.V . Lipatov QFTHEP 2010 , Golitsyno , Russia , September 10, 2010 Calculations III KMR unintegrated PDFs M.A. Kimber, A.D. Martin, M.G. Ryskin, PRD 63, 114027 (2001) 2 f q x , k 2 , 2 ~T q k 2 , 2 [ Pqq вq x , k T P ... Kutak, DIS'08 sea quark density is approximated by the last gluon splitting, i.e. f s q 2 x , k 2 , 2 ~ P qg в f g x , k T , 2 T A.V ...

Еще в разделе: (Показать все результаты (>151) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/Bunichev_singletop_tWb_LHC.pdf
• http://qfthep.sinp.msu.ru/talks2013/Bunichev_QFTHEP2013.pdf
• http://qfthep.sinp.msu.ru/talks2011/asymbrane_QFTHEP11.pdf

International Laser Center of MSU . Home . ... Education . ... Grants . ... 06.10.2014 . October 10, 2014 . 15:00 S.A. Akhmanov Hall, KNO . ... 20.09.2009 . 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . Moscow Vyatichi, November 9 - 11, 2009. ... March 21, 2014 . 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home Research Grants . ... Russian Ministry of Science and Education . ... 2009 ILC MSU Made in: Sebekon IT Solutions . ...

Еще в разделе: (Показать все результаты (>77) - ilc.phys.msu.ru/ )

... Symmetry in Bubble Dynamics . ... An investigation on novel lines is made into the problem of nonlinear bubble dynamics. ... The complete symmetry groups are found for the Rayleigh equation. ... The possible application of the scaling law dynamics to the problem of stable single bubble sonoluminescence is discussed. Conformal symmetry of Laplace equation provides an approach for finding exact solutions for the pulsation of gas bubble tethered to a rigid wall. ...

Еще в разделе: (Показать все результаты (>103) - acs366.phys.msu.su/ )

• General Information

... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...

Еще в разделе: (Показать все результаты (>3) - www.students.chemport.ru/ )

... Guidelines for Paper Submission . ... The program committee will schedule both oral and poster sessions. The abstract and summary of both oral and poster papers are published in the same manner in the Conference Program and the Technical Digest on CD-ROM. ... Oral Sessions . ... Poster Sessions . ... For poster sessions, authors are provided with bulletin boards on which to display their papers, along with a sign indicating their paper numbers, and pushтАУpins or adhesive tape. ... Program . ...

Еще в разделе: (Показать все результаты (>6) - iconolat13.phys.msu.ru/ )

... Academic Programmes . ... Vestnik CIE (in Russian) . FAQs (in Russian) . ... About Moscow University . Links (in russian) . ... Test Your Russian ? ... Lomonosov Moscow State University . ... Day- -Month- -Year- . ... Choose- Male Female . ... Choose- -Other- . ... Russian language for academic purposes major subjects) . Course: . ... Choose- during academic year summer courses . ... Course dates: . ... Choose- professional training refresher course brief refresher course traineeship . ...

Еще в разделе: (Показать все результаты (>16) - www.cie.ru/ )

• Russian Language Programmes :: Academic Programmes :: CIE
• Documents Confirming Academic Background :: Admissions :: CIE

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>7) - www.issp.ac.ru/ )

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>173) - www.philol.msu.ru/ )

• Conference to commemorate A.E. Kibrik :: МГУ :: Филфак :: ОТиПЛ

pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological