This module provides information on server activity and performance. ... Compatibility: Available in Apache 1.1 and later. ... ExtendedStatus To enable status reports only for browsers from the foo.com domain add this code to your httpd.conf configuration file <Location /server-status> SetHandler server-status Order Deny,Allow Deny from all Allow from .foo.com </Location> . ... A machine-readable version of the status file is available by accessing the page http://your.server.name/server-status?auto . ...

Еще в разделе: (Показать все результаты (>45) - neptun.sai.msu.ru/ )

• Manual Page: apachectl - Apache HTTP Server
• Manual Page: logresolve - Apache HTTP Server
• Apache module mod_imap

... To save time, I will only provide ephemerides in 2000 coordinates. ... Note: most the orbital elements used to create these ephemerides were obtained from the International Astronomical Union Circulars (IAUCs), Minor Planet Circulars (MPCs) or the ICQ Comet Handbook. ... The following 1-day ephemeris (March 1, 1997 - October 1, 1997) is from Donald Yeomans of JPL and is based on Reference Orbit #55 (March 4, 1997). 2000 coordinates (March - September, 1997) [3/4/97] . ... Epoch: 1997 Feb. 1.0 . ...

Еще в разделе: (Показать все результаты (>6) - www.issp.ac.ru/ )

• International Science Olympiads
• Comet Observation Home Page (Chernogolovka)

... Новости . ... Posted on October 25, 2011 by admin . ПОБЕДИТЕЛИ ОТБОРОЧНОГО ЭТАПА ПЕРВОГО ОНЛАЙН-ФЕСТИВАЛЯ ДРУЖБЫ ?РУССКИЙ ЯЗЫК ? ... Posted in Новости | Leave a comment . Posted on September 17, 2011 by admin . ... Posted on August 30, 2011 by admin . На сайте Фестиваля опубликованы электронные адреса вузов-соорганизаторов Фестиваля. Дополнения в списки будут вноситься по мере поступления заявок от учебных заведений, выразивших готовность стать соорганизаторами Фестиваля. ...

Еще в разделе: (Показать все результаты (>3) - friendship2011.cs.msu.ru/ )

• На сайте Фестиваля началась публикация работ участников. | Онлайн-фестиваль

... Commission on Paleopedology . ... THE FIRST SCIENTIFIC DESCRIPTION OF EUROPEAN LOESS-PALEOSOL SEQUENCES - Alexander Makeev 08/3/2006 ( 0) . ... paleosol] Re: PalaeoPedology as a Commission - Dr.Stephen Nortcliff 27/11/2003 ( 0) . paleosol] Re: PalaeoPedology as a Commission - dan yaalon 26/11/2003 ( 0) . paleosol] Re: The future of the Paleopedogy Commission - Mermut 28/9/2003 ( 0) . ... Definition of paleosol and geosol; memo to John Catt - Roger Morrison 10/10/99 ( 1) . ...

Еще в разделе: (Показать все результаты (>3) - www.paleopedology.msu.ru/ )

Testing the hypothesis on the 'drift' of parameters in the moving average model / I. G. Erlikh. Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika. 2009. ... Test statistics for checking the conformity of the moving average model to observations are constructed. The statistics are based on sequential processes constructed using residuals and compatible with the equation for estimation of the unknown parameter of the model postulated. ...

Еще в разделе: (Показать все результаты (>13) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Editorial
• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Вестник

... Форумы > Разное > Тема . Автор темы Sasha . Форумы Список тем Новая тема . 08.04.2007 08:45 . ... День Победы, год 2007. ... Со Знамени Победы все-таки убрали серп и молот . http://news.mail.ru/politics/1297266/comments/?page=2 . http://news.mail.ru/politics/1297266/comments/?thread=1C28A8C570A58833 . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>490) - www.mmonline.ru/ )

• MMOnline | Форумы | Преподаватели | А.Т. Фоменко
• MMOnline | Форумы | Аспирантура | Аспирантская вакансия: байесовский анализ в
• MMOnline | Форумы | Разное | Правила пешеходного движения

Dear Sergey Shakin: Per mit me to comment on the accusations br ought against Academician Nekipelov, which I read on the site of Polit.ru. In the first place, it is clear that the editors, having r equested an "academic" r eview of the Nekipelov book, have stretched and abused the comments by Professor Sonin. ... The other matters -- for instance whether ther e is too much citation for a monograph -- are entir ely subjective, matters basically of academic taste. ...

Еще в разделе: (Показать все результаты (>21) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/sc_pub/presman_sc_pub_2011.pdf

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:39:53 Sat , 04 Dec 2010 21:16:12 GMT darkhan [24:e368337edc67] * Automata.py ( modified ) Correction in Automata Sat , 04 Dec 2010 20:44:37 GMT darkhan [23:c74a9885bf04] * Automata.py ( modified ) * State.py ( modified ) Comment in English Sat , 04 Dec 2010 20:39:27 GMT darkhan [22:749533cdfc67] * State.py ( ...

Еще в разделе: (Показать все результаты (>174) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=24%3Ae368337edc67&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=c74a9885bf048a4938c290470e671c1c9c68dd33&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=23%3Ac74a9885bf04&limit=100&mode=stop_on_copy

... List of all selected researchers by country of host institution (in alphabetical order within each country group): http :// erc.europa.eu / pdf / ERC _StG2010Results_All_by_Country. pdf Lists of selected researchers by domain (in alphabetical order): Social Sciences and Humanities: http :// erc.europa.eu / pdf / ERC _StG2010Results_SH. pdf Life Sciences: http :// erc.europa.eu / pdf / ERC _StG2010Results_LS ... Calls for proposals: published annually in summer with deadlines in autumn. ...

Еще в разделе: (Показать все результаты (>32) - ideas.msu.ru/ )

... Il etait une fois nous deux . ... salut . Et si tu n'existais pas . ... Et si tu n'existais pas Dis-moi pourquoi j'existerais Pour traоner dans un monde sans toi Sans espoir et sans regret Et si tu n'existais pas J'essaierais d'inventer l'amour Comme un peintre qui voit sous ses doigts Naоtre les couleurs du jour Et qui n'en revient pas Et si tu n'existais pas Dis-moi pour qui j'existerais Des passantes endormies dans mes bras Que je n'aimerais jamais Et si tu n'existais ...

Еще в разделе: (Показать все результаты (>14) - optics.sinp.msu.ru/ )

Научно-образовательный центр Геномного секвенирования МГУ . Научно-образовательный центр геномного секвенирования факультета биоинженерии и биоинформатики МГУ объявляет конкурс на поддержку проектов, использующих методыљ высокопроизводительного секвенированияљ (NGS) и проводимых исследователями (исследовательскими группами) МГУ.љ ... в МГУ имени М.В. Ломоносова, проводимый научно-образовательным центромљгеномного секвенирования факультета биоинженерии и биоинформатики МГУ,љпоступило 23 заявки.љ ...

Еще в разделе: (Показать все результаты (>3) - genseq.fbb.msu.ru/ )

• call - НОЦ геномного секвенирования ФББ МГУ

Alignmentfree telomere length estimation from whole genome NGS data Szymon M. Kielbasa1Jelle Goeman2Hein Putter1 NL Consortium orret Boomsma3 , , Go , , D , Eline Slagboom1Kai Ye4 , 1 Department of Medical Statistics and Bioinformatics, Leiden University Medical Center, Leiden, Department for Health Evidence, Radboud university medical center, Nijmegen, The Netherlands Netherlands Twin Register, Department of Biological Psychology, VU ...

Еще в разделе: (Показать все результаты (>88) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/31.pdf

... Next: Changing Image Resolution Up: Microscope Parameters Data Previous: Microscope Parameters Data Contents Index . Femtoscan and Nanoscope file formats have text headings, which can be viewed using menu command View/ Parameters.. ... It is possible to change the comments written in the file using menu command View/ Comment.. ... Next: Changing Image Resolution Up: Microscope Parameters Data Previous: Microscope Parameters Data Contents Index Filonov 2005-02-04 ...

Еще в разделе: (Показать все результаты (>32) - www.spm.genebee.msu.ru/ )

• FemtoScan Online FAQs
• Instrument panel
• Connection to a Server

. You can subscribe to a newsletter with the contents of the current issue. To receive the E-mail alerts please fill the fields below and provide a working email address. First name . Last name . Email . Subscribe Unsubscribe . Enter text shown right: .

Еще в разделе: (Показать все результаты (>618) - zmmu.msu.ru/ )

• Morphometric variation of the common shrew Sorex araneus in Ukraine, in
• Types Database
• Cladistic analysis of the dormouse genus Graphiurus Smuts, 1832 (Rodentia:

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Conferences . M.V.Lomonosov Moscow State University . Faculty of Mechanics and Mathematics . ... Moscow State University . 119991 Moscow RUSSIA . ... Contact: room A1620, Moscow State University main building . ... Our " Conferences " section has been updated . ...

Еще в разделе: (Показать все результаты (>33) - higeom.math.msu.su/ )

? . Admission . Студентам . Аспирантам . Защиты диссертаций . Контакты . F.A.Q. Search . News . History . Русский . English . Карта сайта . Обратная связь . Username * . Password * . Request new password . Home . Заголовок . Автор . Введите полное название кафедры или имя автора . Tags . Категория: . Прочее . 8 January 2015 - 11:39 Автор: admin . Read more about ---- . Log in to post comments . ї 2016 Механико-математический факультет МГУ им. М.В. Ломоносова . О сайте .

100. SWX - Главная