... Politeness Strategies One of typical politeness strategies in English is softening orders, requests, critical opinions, etc., by asking a question instead of making an imperative sentence or a statement. ... N 1 2 3 4 5 6 7 8 9 10 Question Why don't you speak to him directly? ... You don't seem to know his home address, do you? ... Would you like some coffee? ... Could I see your tickets? Do you mind if I asked my friend to go with us? ... Do you mind if I asked my friend to go wit us?) ...
[
Текст
]
Ссылки http://www.ffl.msu.ru/research/vestnik/2-2008-gorodetskaya.pdf -- 157.0 Кб -- 02.02.2013
[
Текст
]
Ссылки http://ffl.msu.ru/research/vestnik/2-2008-gorodetskaya.pdf -- 157.0 Кб -- 25.02.2013 Похожие документы
The laboratory runs currently several scientific projects aimed at the foundations of quantum information science (the theories of quantum measurement and entanglement, design and analysis of quantum cryptographic protocols, atoms dynamics in optical dipole trap, etc.), applications of quantum theory to modeling quantum interference phenomena in multilevel atoms interacting with optical and magnetic fields (dark resonance spectroscopy), and exploring ... Physics 96 (4), 629-642 (2003). ...
... Start from the camp inland towards 11 pine-trees ( Pinus sylvestris ), that are marked by notches. ... Further on there grows crowberry ( Empetrum hermaphroditum ), also marked by two notched trees. Then turn to the right, get deeper into the forest and reach bilberry-bushes ( Vaccinium myrtillus ), growing around a notched pine-tree. ... Walk about 50 metres to the left along the edge and then enter the forest. There are birches ( Betula pubescens ), marked by notches. ... phase . ...
... Data . ... Services . ... Solar energetic particles . ... N -d SW Conditions : Time profiles of the key geomagnetic ( Ap and Dst indices), solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM) parameters observed in the N day vicinity of the geomagnetic disturbed day. N -d Map of Solar Events : Map of solar surface events occurred within N day vicinity of the moment when the solar wind expansion (which causes the geomagnetic event) started. ... WIND . ...
FORUM "Universities on their way towards to the new quality of education" June 10, 2008 Moscow, 27B Lomonosov Avenue, Lomonosov Moscow State University, the First Building |9.00 - |Registration of the Forum participants. Ground floor, | ... Approaches to form the quality of education |left wing, | ... Strategic partnership of universities and business |right wing, | ... 13.00 - 14.00 Eurasian Association of Universities meeting (Ground floor, left wing, auditorium 3) ----------------------- ...
... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...
... FAULT , LATERAL ( right -, left -) . горизонтальный сброс (правосторонний, левосторонний) . ... Правосторонний сброс - сброс, у которого обнажающиеся породы оказываются смещенными вправо относительно наблюдателя. ... При известных простирании и падении, Хилл ( Hill , 1947) предложил следующую классификацию: право- (или лево -) сторонний нормальный сброс, право- (или лево -) сторонний обратный сброс, право- (или лево -) сторонний взброс. ... термины fault, normal и faull displacement, lateral. ...
. I welcome everybody to my personal page!!!!! . # . 19 . HT: . 1.80m . WT: . 80 kg . Bats . Left . Throws . Right . Born . Years in baseball . 7 . Years with a team . 7 . Positions . P, 3B, C . Favourite player . Cal Ripken jr . Favourite team . Baltimore Orioles
B eautiful lake . Lake in the mountains . Mountains . ... Standard Taiwanese scenery . Lake in Chinese style . ... Happy christmas (with Fady from Jordan and Fredrik from Sweden) . Christmas party (in black suit - vice-president of Chio-Tung University) . Downtown (with the guys from Jordan and some guy from Taiwan) . It is me with the university on a background . ... In the mountains . Traditon of burning money before Chinese New Year . ... Good ad of Taiwanese alcohol . ...
... Levin M. The embryonic origins of left-right asymmetry // Crit. ... Biol. ... McGrath J., Somlo S., Makova S. Xin Tian and Brueckner M. Two Populations of Node Monocilia Initiate Left-Right Asymmetry in the Mouse // Cell V.114, 1, 2003. ... Nonaka S., Shiratori H., Saijoh Y., Hamada H. Determination of left-right patterning of the mouse embryo by artificial nodal flow // Nature V.418, 6893, 2002. ... The Ion Channel Polycystin-2 Is Required for Left-Right Axis Determination in Mice // Current Biol. ...
Figure 7. Temperature dependence of resistivity for PbTe 0.92 S 0.08 crystals doped with different amounts of In (on the left) and Se (on the right). The concentration of indium (in at.%): 1, 0.15; 2, 0.31; 3, 0.49; 4, 0.71. The concentration of Se in the samples of Pb(Te 1-y Se y ) 0.92 S 0.08 (in mol.%): 5, 21; 6, 27; 7, 34; 8, 40; 9, 46 /20/.
... The purpose of the article is to analyze the legal position of the European Court of Human Rights on the enforcement of judicial decisions by the domestic public authorities. ... The Court s position is that the execution of judgment is a part of the obligation of states to ensure the access to justice in accordance with Article 6 of the European Convention on Human Rights. ... European Court of Human Rights, European Convention on Human Rights, enforcement of judicial decisions. ...
... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...
... Recently Professor Bagotsky summarized his uniquely long scientific work in a brief article "Fuel Cells, Batteries, and the Development of Electrochemistry" published in the "Electrochemistry Past, Present, and Future" issue of J. Solid State Electrochemistry(Vol.15,p.1559,2011).Hementionedthatbecause he was working simultaneously in the fields of fundamental and applied electrochemistry, he had the opportunity to experience the mutual influence in the development of these two fields. ...
[
Текст
]
Ссылки http://www.elch.chem.msu.ru/bagotsky/interface2013.pdf -- 868.1 Кб -- 09.05.2014
[
Текст
]
Ссылки http://electr003.chem.msu.ru/bagotsky/interface2013.pdf -- 868.1 Кб -- 09.05.2014 Похожие документы
... We have compiled the Catalogue of extragalactic supernovae using the GCVS card catalogue. ... Doubtful (?), or rejected (-) SN 8 A1 --- RemFlag [*] The '*' indicates a remark in sn_rem.dat 10- 19 A10 --- Gal Parent galaxy designation 21- 22 I2 h RAh Right Ascension 1950 of Parent galaxy 23- 24 I2 min RAm Right Ascension 1950 (minutes) 25- 28 F4.1 s RAs Right Ascension 1950 (seconds) 29 A1 --- DE- Declination 1950 (sign) 30- 31 I2 deg DEd Declination 1950 of Parent ...
... Поиск по МГУ | Лента новостей | ... О проекте . ... Please, enter the code that you see below in the input field. This is for blocking bots that try to post this form automatically. If the code is hard to read, then just try to guess it right. If you enter the wrong code, a new image is created and you get another chance to enter it right. ... 2003 2011 MsuNews.Ru Новости МГУ . 2003 2011 Разработка и дизайн MMForce.Net . ... Экспорт новостей (RSS) ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... You should add the following lines to your PC GAMESS/Firefly job: $ELDENS IEDEN=1 $END $ELPOT IEPOT=1 $END $CUBE CUBE=.T. mesh=coarse $END This will produce cube info for both density and ESP. You can choose to specify only $ELDENS or $ELPOT group, or both. ... Similarly, if $ELDENS group is provided with IEDEN = 1, MORB = 0 and the $CUBE group is provided with cube=.t., then a 3D "cube" of total density data will be punched. ... PC GAMESS v. 6.1 specific documentation . ...