download:rn-080423 ]] . CompHEP . ... THE VERSION 4.5.0rc2 IS A TEST RELEASE! ... 4.5.0rc1: some tiny bugs in generated event files in LHE . 4.4.113: Temporary stopper for Latex generation for 2Б†’N, N>4 . ... 4.4.98: working symb_batch.pl with new option for parallel calculations . ... 4.4.91: Three bugs in generation of session.dat with s_comphep . ... 4.4.90: Several bugs in generation of session.dat with s_comphep . ... 4.4.96: CompHEP-ROOT interface, for histogramming only . ... News . ...

Еще в разделе: (Показать все результаты (>90) - comphep.sinp.msu.ru/ )

• install [CompHEP]
• download:cinterfaces101 [CompHEP]
• download:cinterfaces301 [CompHEP]

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>4933) - cdfe.sinp.msu.ru/ )

• CDFE => Useful links
• CDFE => Online Services

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>2231) - swx.sinp.msu.ru/ )

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>37) - ideas.msu.ru/ )

• http://ideas.msu.ru/news/19_10_2010/Press_release.pdf

... 2) Place of the conference has been changed from the lecture hall V-3 to the lecture hall V-2 in the First Academic Building of MSU on New Territories (it is marked on the map of MSU campus on the web-site). ... 6) For participants from abroad Russia here is additional information about the money exchange - we would recommend you to bring at least 300-400 euro with you in cash because of the following considerations: . ... for one dinner in the evening you should calculate not less than 15-20 euro ....

Еще в разделе: (Показать все результаты (>282) - polly.phys.msu.ru/ )

• Russia.ru - Chair of Polymer and Crystal Physics

UGENE toolkit: Bioinformatics "Swiss army knife" Yuriy Vaskin Novosibirsk State University, Novosibirsk, Pirogova St. 2, 630090, vaskin90@gmail.com M. Fursov NCIT Unipro, Novosibirsk, Lavrentieva ave. 6/1, 630090, mfursov@unipro.ru In the age of information technologies it is not surprising that biologists use special computer programs in their day-to-day work. ... Currently there are a lot of data formats and types which are spread throug various biological databases. ...

Еще в разделе: (Показать все результаты (>291) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/190.pdf
• OMICS Startup Contest
• MSU campus map

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... International . ... Partners . ... All partners . ... International media readings . The 6th International Media Readings in Moscow "Mass Media and Communications 2014" . ... Organizers: Faculty of Journalism, Lomonosov Moscow State University . ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>77) - www.journ.msu.ru/ )

• Conferences :: Department of Journalism, M. V. Lomonosov Moscow State
• Students of the Faculty of Journalism, MSU Visited the Humboldt University of

Sign in Register . ... Resources . ... info@ecfs.msu.ru . All contacts . ... Home Forum Ongoing consultations/ Текущие онлайн конференции . ... Search in section Everywhere Основная дискуссия -Ongoing consultations/ Текущие онлайн конференции -Прошедшие онлайн конференции -Общая дискуссия -Евразийское почвенное партнерство . ... last comment . ... Last answer . ... Contacts . The Department of land resources . ...

Еще в разделе: (Показать все результаты (>43) - ecfs.msu.ru/ )

• About Eurasian Center for Food Security | ECFS
• Draft Plan of Action for Eurasian Subregional Partnership | ECFS

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>5) - scon155.phys.msu.ru/ )

• Best search engines for finding scientific information in the Internet:

sparallel.ru . Older posts . Newer posts . Posted by admin . ... Continue reading . Posted in Разное . Мар 17 . ... В интернет-магазине Cityboots представлена последняя коллекция обуви от Fabi по доступной цене. ... Posted in Ботинки . ... Широко известный канадский бренд бюджетной мужской и женской обуви. ... Posted in Кросовки . ... Posted in Сандалии . ... совокупный доход, получаемый этими ?обуви? или ? ... Экологически чистая обувь, обувь которая ?дышит? ? ... обувь изо льна. ...

Еще в разделе: (Показать все результаты (>4) - sparallel.ru/ )

• sparallel.ru - Part 106

. Russian Version . Faculty of Computational Mathematics and Cybernetics . The Department of Operations Research . About Us . News . ORM2016: actual announcement and abstract templates . Archive of . Conferences ORM . Study . Undergraduates . Postgraduate education . Bachelor Program . Master Program . Faculty . Lecture . notes . Contacts . Graduates . New . publications . Create Date : 23.05.05 . The Department of Operations Research

Еще в разделе: (Показать все результаты (>30) - io.cmc.msu.ru/ )

• Кафедра Исследования Операций

University Satellites and . Space Science Education . ... The purpose of the developed scientific - educational program complex is creation on the Earth on the base of telemetry data of virtual model of microgravitational environment in which experiments are carried out, and virtual motion model of of the space vehicle. ... The developed program complex concerns to the class of the distributed program systems. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>68) - cosmos.msu.ru/ )

ACCL: what is that and what it is for . Animal Cell Culture Laboratory (ACCL) of the Faculty of Bioengineering and Bioinformatics was created in 2001 as one of the first service groups located in Laboratory Building Б of Moscow State University . ... Other persons are also welcome on the terms of individual agreement (see Services and Scientific Program ). We also have our own program of scientific research (see Scientific Program ). ...

Еще в разделе: (Показать все результаты (>260) - www.genebee.msu.ru/ )

• Selected Scientific Journals - Search Engines
• Biochemistry (Moscow), Vol
• Notes on searching by similarity

... Assist O&T head on special projects, automation and process improvement initiatives related to Back Office . ... Monthly close functions for Back Office, monthly/quarterly reporting and analysis, track specialized spending, mid-year forecast and annual budget development and reporting, conduction of various analyses of each area's key business drivers. ... Monthly invoice and P&L processing for Back Office departments including the processing of all client and vendor payments, account payable. ...

Еще в разделе: (Показать все результаты (>140) - www.physcareer.ru/ )

• Supply Network Operations- Supply Chain Manager-CS 00001567, компания Procter /
• Summer Internship Program with The Nielsen Company / Стажировки / Physcareer.ru

... THE LJUBLJANA SUMMER SCHOOL 2006 . ... THE LJUBLJANA SUMMER SCHOOL 2006 is a new intensive programme open to both undergraduate and graduate students of Business, Economics, and other fields of Social Sciences. The programme was created at the Faculty of Economics in Ljubljana in order to impart knowledge by taking full advantage of our country s unique geographical position: the meeting point of East and West. ... The Summer School s aim is to learn by applying knowledge to real-life situations. ...

Еще в разделе: (Показать все результаты (>166) - www.mgubs.ru/ )

• Высшая школа бизнеса МГУ им. Ломоносова

.. , . . , . .. (e-mail: galami7@mail.ru) , , " ", , creative class, informational workers, social inequality, "Homines Aeris", netocracy , . . , . In article different options of conceptualization of a creative class are considered, its characterologic signs are allocated. Attempt of definition of its place in social structure of modern societies is made. Those social effects which are connected with formation of a creative class are analyzed.

Еще в разделе: (Показать все результаты (>41) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2013/3/12.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/2/05.pdf
• http://www.socio.msu.ru/vestnik/archive/2014/1/13.pdf

.

Еще в разделе: (Показать все результаты (>67) - lav01.sinp.msu.ru/ )

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>6) - www.rlcentre.com/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>25) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...

Еще в разделе: (Показать все результаты (>44) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/literature/WOS.pdf