Oxana V. Dzhosan oxanad@mail.ru Scientific Data Visualization System for HighPerformance Computing MSU_VIZ Visualization system MSU_VIZ for Blue Gene /P Blue Gene /P MSU_VIZ Blue Gene /P front-end MSU_VIZ PC workstation Display MSU_VIZ 2D display - Data calculation - Video rendering - Video enhancement - Video compression - Video resizing - Display ... It is used for stereoscopic displays. ...
[
Текст
]
Ссылки http://angel.cs.msu.su/~oxana/ibm/Dzhosan_visualization_sm.pdf -- 2904.2 Кб -- 29.04.2009 Похожие документы
. КОМПЬЮТЕРЫ . Решение астрономической задачи N тел на кластере из ГПУ (pdf) . Exploring weak scalability for FEM calculations on a GPU-enhanced cluster (pdf) . Using GPUs to Improve Multigrid Solver Performance on a Cluster (pdf) . ClawHMMER: A Streaming HMMer-Search Implementation (pdf) . Проект Folding@Home . Лаборатория Параллельных информационных технологий НИВЦ МГУ .
... 8 February , 2014 SAI seminar (Ryde et al 2010) 5 Thermal emission from GRB jet progenitor observer photon jet Photosphere (=1) · · · · Photons are not produced at the photosphere We have to calculate radiative transfer We need to know where the photons are produced We construct the expression for effective optical depth in relativistic flow considering random walk process in relativistic flow SAI seminar 6 8 ... 8 February, 2014 SAI seminar 28 ...
[
Текст
]
Ссылки http://master.sai.msu.ru/media/presentations/2014/20140208_Shibata.pdf -- 1131.7 Кб -- 07.02.2014 Похожие документы
... Galeev Elfat Mikhailovich . ... Elfat Mikhailovich Galeev was born on 19.03.1952 in village Chur of Iak-Bodinskii region of Udmurtian Soviet Socialist Republic. After accomplishing his post-graduate studies in 1977 he was taken on the staff of the departmetn of general problems of control. ... He has been a professor of the department since 1998. ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...
. # . Home . Services . Interaction . Calculate Hydrogen bond, Water bridges and Hydrophobic interaction for . Home Browse Download Help About Us . List of complexes . Pfam families . SCOP families . Interaction classes . Interaction modes . GO terms . ERROR! File was not found. NPIDB team 2003 - 2016 . text .
... Вычисление обратной функции нормального распределения вероятности. SF51R_c вычисляет значение x такое, что x 1/(2 ) 1/2 e - t*t / 2 dt = P , - где P - заданное значение вероятности (0 < P < 1). ... A.J.Strecok, On the Calculation of the Inverse of the Error Function, Mathematics of Computation, 22(101), 1968. real sf51r_c (real *p, integer *ierr) . ... ierr - . ... когда заданное значение вероятности p не принадлежит интервалу (0, 1); значение функции полагается равным 3.4e38. utsf12_c - . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Directives | ... Apache HTTP Server Version 2.0 . ... This module controls the setting of the Expires HTTP header and the max-age directive of the Cache-Control HTTP header in server responses. The expiration date can set to be relative to either the time the source file was last modified, or to the time of the client access. ... access . ... If set to On , the headers will be added to served documents according to the criteria defined by the ExpiresByType and ExpiresDefault directives ( q.v. ). ...
... Scientific goals . ... Automatic gaze stabilization corrector . Scientific equipment . ... IMISS-1 . ... Comparing the measured and calculated values we?ll find out if it is possible to use microelectromechanical inertial measuring modules in an automatic gaze stabilization corrector , and calculate the value of changes of microsensors? instrumental errors under the space conditions as against the Earth ones. ...
... We present some results of new calculations of D" ( t ) the second derivative of the Moon's elongation as a function of time. ... Let X be a set of all preserved recordings of observations of ancient Sun and Moon eclipses (see the list in [ 2 ], pp. 167 271): let A be a set of eclipses described in X (any eclipse a A may have some records corresponding to it and form X ( a )). ... The recount of dates t ( a 0 ), a 0 A ,( 700) < t ( a 0 ) < (+400), was first made by N. A. Morosov. ...
I NSTITUTE OF PHYSICS PUBLISHING PHYSICAL B IOLOGY Phys. Biol. 3 (2006) 121129 doi:10.1088/1478-3975/3/2/004 Direct simulation of plastocyanin and cytochrome f interactions in solution I B Kovalenko1,AMAbaturova1, P A Gromov2,DMUstinin1, E A Grachev2, G Yu Riznichenko1 and ABRubin1 1 2 ... 2006 Online at stacks.iop.org/PhysBio/3/121 Abstract Most biological functions, including photosynthetic activity, are mediated by protein interactions ... We use this structure in our simulation. ...
... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...
Academy of Science, Engineering and Technology International Journal of Mathematical, Computational, Physical and Quantum Engineering Vol :8 No:10, 2014 Application of Adaptive Neural Network Algorithms for Determination of Salt Composition of Waters Using Laser Spectroscopy Tatiana A. Dolenko, Sergey A. Burikov, Alexander O. Efitorov, Sergey A. Dolenko ... Nickolov, "Determination of salts in water solutions by a skewing parameter of the water Raman band," Applied Spectroscopy, vol. 38, no. 4, pp. ...
[
Текст
]
Ссылки http://rswater.phys.msu.ru/en/articles/2014/Application.pdf -- 172.0 Кб -- 17.12.2014 Похожие документы
In Silico Biology 3 (2003) 197204 IOS Press 197 The Channel in Transporters is Formed by Residues That Are Rare in Transmembrane Helices Olga V. Kalinina1,*, Vsevolod J. Makeev1, Roman A. Sutormin1, Mikhail S. Gelfand1,2 and Aleksandra B. Rakhmaninova2 1 2 State Scientific Many genes encoding known or putative transport proteins are found in bacterial genomes. ... It is based on the analysis of amino acids frequencies in bacterial secondary transporters. ... Proteins 51, 8595. ...
[
Текст
]
Ссылки http://storage.bioinf.fbb.msu.ru/~roman/insilicobiol_2003.pdf -- 411.4 Кб -- 21.12.2005 Похожие документы
... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F velocity potential, H depth, vector of bottom deformation, 0 initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...
[
Текст
]
Ссылки http://ocean.phys.msu.ru/science/nosov/EGU2010_initial_condition.pdf -- 1885.8 Кб -- 12.01.2012 Похожие документы
... Two-dimension linear regression model. ... The econometric modeling of time series . ... The course aims to provide students with basic models and methods of econometric modeling of financial time series. ... The course considers in detail the major methods of econometric modeling of time series, in particular modeling by stochastic processes, modeling of stationary and non-stationary time series, the spectrum analysis of time series. ... The problem of tax optimization under a given state budget. ...
Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete
[
Текст
]
Ссылки http://mph.cs.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cs.msu.su/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011
[
Текст
]
Ссылки http://mph.cmc.msu.ru/mph/arh/blank/1999pro-en.doc -- 190.5 Кб -- 17.02.2011 Похожие документы
... The main interest of researchers was focused on TiO2:Co and TiO2:V thin films, that reveal an essential difference in their behavior: TiO2:Co films demonstrate either strong magnetization, MO response or AHE independently on presence or absence of magnetic Co clusters inside the films. ... It has been found that: thin films TiO2:Co(0.5%, 1.3% and 5%) have either magnetization or MO signal of Transversal Kerr effect with the absence of magnetic clusters. ...
[
Текст
]
Ссылки http://magn115.phys.msu.ru/Rus/DETI2/AnnoRusPart2012.pdf -- 121.5 Кб -- 17.01.2014
[
Текст
]
Ссылки http://magn.phys.msu.ru/Rus/DETI2/AnnoRusPart2012.pdf -- 121.5 Кб -- 17.01.2014 Похожие документы