... T. A. Dolenko, S. A. Burikov, K. A. Laptinskiy, and O. E. Sarmanova, Improvement of the fidelity of molecular DNA computations: control of DNA duplex melting using Raman spectroscopy, Laser Physics, v. 26, No 2 Jessica M. Rosenholm, Igor I. Vlasov, Sergey A. Burikov, Tatiana A. Dolenko, and Olga A. Shenderova. ... A.O. Efitorov, S.A. Burikov, T.A. Dolenko, I.G. Persiantsev, S.A. Dolenko. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>44) - rswater.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

... What's new . ... The new version of the General Catalogue of Variable Stars (GCVS4.2) revised taking into account the new data accumulated since the 4th GCVS edition for the constellations: Canis Minor, Capricornus The new version of the GCVS ! ... The new version of the General Catalogue of Variable Stars (GCVS4.2) revised taking into account the new data accumulated since the 4th GCVS edition for the constellations: Apus, Cancer, Canes Venatici and Canis Major The new version of the GCVS ! ...

Еще в разделе: (Показать все результаты (>136) - sai.msu.ru/ )

• GCVS Research Group: Recent publications
• Презентация PowerPoint

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . ... Links . ... CDFE => Links . ... Space Physics Online Data Services at MSU SINP . Japan Atomic Energy Research Institute Nuclear Data Center . Korean Atomic Energy Research Institute Nuclear Data Center . MacNuclide Nuclear Data Base Management System . ... Radiation Safety Information Computational Center , Oak Ridge National Laboratory . ... Los Alamos National Laboratory Nuclear Data Viewer . ...

Еще в разделе: (Показать все результаты (>48) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page
• CDFE => Publications
• CDFE => Online Services => Dynamic atomic nuclei deformation animation

Backlinks to WebLeftBarCookbook in System Web ( Search all webs ) . ... NEW - 26 Aug 2011 - 18:18 by ProjectContributor . ... NEW - 02 Sep 2010 - 17:49 by ProjectContributor . ... NEW - 18 Mar 2011 - 19:48 by ProjectContributor . ... Copyright by the contributing authors. All material on this site is the property of the contributing authors. Ideas, requests, problems regarding Foswiki? ...

Еще в разделе: (Показать все результаты (>1720) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) WebLeftBarCookbook < System < Foswiki
• UserDocumentationCategory < System < Foswiki
• (backlinks in all Webs) FamFamFamFlagIcons < System < Foswiki

... Design of small molecule antiviral compounds against tick-borne encephalitis, dengue fever, and other diseases caused by flaviviruses . ... K. N. Sedenkova, E. V. Dueva, E. B. Averina, Y. K. Grishin, D. I. Osolodkin, L. I. Kozlovskaya, V. A. Palyulin, E. N. Savelyev, B. S. Orlinson, I. A. Novakov, G. M. Butov, T. S. Kuznetsova, G. G. Karganova, N. S. Zefirov. Synthesis and Assessment of 4-Aminotetrahydroquinazoline Derivatives as Tick-Borne Encephalitis Virus Reproduction Inhibitors . ...

Еще в разделе: (Показать все результаты (>18) - qsar.chem.msu.ru/ )

• Cytokinin Receptors - Laboratory of Medicinal Chemistry
• Molecular switches - Laboratory of Medicinal Chemistry

... Полная версия этой страницы: Работа в Samsung . Студенческий форум Физфака МГУ > Общий > Работа . ... Telecommunication Network . ... Job Summary: The Optical Engineer will be involved in the design, fabrication and testing of optical/digital imaging system for mobile devices. ... Required Skills: Must have proven optical design and algorithm skills, lens design experience using code-V or equivalent lens design software. ... Company: Samsung Electronics Telecommunication Network Business . ...

Еще в разделе: (Показать все результаты (>575) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > MSc/PhD positions in the Optical Sensors for
• Студенческий форум Физфака МГУ > [NEW!] Аспирантура во Франции
• Студенческий форум Физфака МГУ > Casimir vacuum energy and the semiclassical

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... BDRG . ... DEPRON . ELFIN-L . ... The satellite ?Mikhailo Lomonosov? is based on the platform of the spacecraft ?Kanopus-B? developed by the All-Russia reasearch and development institute of electromechanics named after Iosiphyan (VNIIEM). ... Scientific equipment will weight about 120 kg, while the total weight of the satellite will be about 450 kg. ...

Еще в разделе: (Показать все результаты (>59) - lomonosov.sinp.msu.ru/ )

• Mikhail Lomonosov ? the Pioneer of Russian Science | Университетский спутник
• DEPRON | Университетский спутник "Ломоносов"
• IMISS-1 | Университетский спутник "Ломоносов"

... Moscow State University . ... Research . ... Lecturer, School of Physics, . ... vladimir.lobaskin@ucd.ie . Vladimir Lobaskin obtained a First Class Honours Degree in Solid State Physics (1989) from Chelyabinsk State University (CSU) and a Ph.D. (1993) from the Urals State Technical University (UPI). He took then a lecturer position in the Physics Department of Chelyabinsk State University. ... In 2008 he moved to the School of Physics at University College Dublin (UCD) . ...

Еще в разделе: (Показать все результаты (>61) - nanofluidics.phys.msu.ru/ )

• Olga I. Vinogradova
• Maduar
• Theses

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: €аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>62) - ecfs.msu.ru/ )

• The world Bank's agriculture and rural development in the region Europe and
• Resources | ECFS
• Draft Plan of Action for Eurasian Subregional Partnership | ECFS

... Home Our Team Staff Lora S. Nikolaeva . ... Kalinin, USSR; graduated from Lomonosov Moscow State University, Mechanics and Mathematics Department in 1961. Work at Lomonosov Moscow State University, Chemistry Department from 1967. ... Joint investigstions with Department of Chemistry of Tver State University and Biology Department of Lomonosov Moscow State University have been made. ... Colloquium on 24.12.12 20 Dec 2012 . ... Department of Chemistry . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• PhDi Laboratory of Chemical Thermodynamics

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ Recommendations of the International Workshop "Local Tsunami Warning and Mitigation" Petropavlovsk-Kamchatskiy, Russia, September 10 - 15, 2002 Analysis of the state-of-the-art of the local tsunami participants testifies to the potential of a significant methodology and hazard reduction. ...

Еще в разделе: (Показать все результаты (>25) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E19_Puspito.pdf
• http://seac47-2.phys.msu.ru/proc/E08_Inoue.pdf

... English: ps (gzipped) 9 pages . arXiv.org e-Print archive: http://arXiv.org/abs/math.CO/0109122 . Abstract. ... Topological charge of the real periodic finite-gap sine-Gordon solutions. ... arXiv.org e-Print archive: http://arXiv.org/abs/math-ph/0111039 . ... English: ps Russian: ps 5 pages . ... A note on the real fermionic and bosonic quadratic forms: their diagonalization and topological interpreation. ... arXiv.org e-Print archive: http://arXiv.org/abs/math-ph/0110032 . ...

Еще в разделе: (Показать все результаты (>160) - higeom.math.msu.su/ )

• Publications (Russian)
• INVITED ADDRESSES:
• Knots (English)

Division of Experimental and Theoretical Physics . ... Theory of gauge fields and its applications to elementary particle physics . Unified theory of physical effects and phenomena in systems of particles with electromagnetic interaction . ... Methods of Lobachevsky geometry in non-linear problems of mathematical physics . ... Interaction of ultra-short laser pulses with matter, investigations of physical properties of new materials for quantum- and optoelectronic systems . ... Materials science . ...

Еще в разделе: (Показать все результаты (>31) - foroff.phys.msu.ru/ )

• Postdoctoral training (General Physics and Wave Processes)
• Offered courses

... This course is dedicated to the main principles, methods and techniques of parallel programming oriented at resolution of resource-intensive tasks physically and in non-linear optics in particular. The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... Antonov, A.S. Parallel Programming Using MPI. ...

Еще в разделе: (Показать все результаты (>17) - engineering.phys.msu.ru/ )

• Introduction to Linux

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ­ velocity potential, H ­ depth, ­ vector of bottom deformation, 0 ­ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>15) - ocean.phys.msu.ru/ )

... Institute Laboratory-Chairs . ... On the other hand, there is an input of a concept of reference system relative motion as invariance breakdown in the intervals of particles motion. ... In pseudo-Euclidean spaces, there is a proved existence of two fundamental types of motion – exterminable, which can be exterminated via matching a reference system, and non-exterminable, which cannot be exterminated via matching a reference system, and which also lays the base for the phenomenon of the course of...

Еще в разделе: (Показать все результаты (>525) - chronos.msu.ru/ )

• Russian Interdisciplinary Temporology Seminar
• THE PROBLEMS IN EXPERIMENTAL FOUNDATION OF CAUSAL MECHANICS
• A METHOD FOR DETERMINING ECOSYSTEM NORMAL FUNCTIONING REGIONS

... Частичная проблема собственных значений . ... Частично . ... Partially immersed body . ... Частичное отображение . ... Doppler frequency shift . ... Number of specimens in the population . Число закрутки (потока) . ... A base two (ten) number . ... The Reynolds number based on the relative velocity between the droplet and the gas . ... Чисто геометрический характер . Purely geometric nature . ... The condition number of a matrix is a measure of sensitivity to perturbations of its elements . ...

Еще в разделе: (Показать все результаты (>206) - num-anal.srcc.msu.ru/ )

• БЧА НИВЦ МГУ. ZF30R_P. Решение системы уравнений общего вида
• БЧА НИВЦ МГУ. ZF30R_C. Решение системы уравнений общего вида

International Laser Center of MSU . Home . ... Education . ... Grants . ... 06.10.2014 . October 10, 2014 . 15:00 S.A. Akhmanov Hall, KNO . ... 20.09.2009 . 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . Moscow Vyatichi, November 9 - 11, 2009. ... March 21, 2014 . 15:00 S.A. Akhmanov Hall, Nonlinear Optics Bld. ... Home Research Grants . ... Russian Ministry of Science and Education . ... 2009 ILC MSU Made in: Sebekon IT Solutions . ...

Еще в разделе: (Показать все результаты (>217) - ilc.phys.msu.ru/ )

• Laboratory of solid-state lasers and coherent spectroscopy
• Grants
• "Computers and measurements" practical course laboratory

... id #1550 . Journal of Immune Based Therapies and Vaccines [J Immun Based Therap Vaccin] . Common information . ... no information] . ... 1476-8518 . ... since 2003-01-01 till today . ... FREE electronic journal! ... http://www.jibtherapies.com/home/ . ... today . ...

Еще в разделе: (Показать все результаты (>69) - journals.genebee.msu.ru/ )