... Grant of Ministry of Science and Techologies of Russian Federation, subprogram "Engineering enzymology . ... The development of fundamentals and technology of sulfur removal from gas and waste water streams by immobilyzed biocatalytic systems . ... Grant of Ministry of Science and Technologies of Russian Federation subprogram "Biocatalytic technologies " . Ministry of Science and Technologies of Russian Federation . ... Grant of Ministry of Science and Technologies of Russian Federation . ...

Еще в разделе: (Показать все результаты (>129) - www.enzyme.chem.msu.ru/ )

• Education
• B I O C A T A L Y S I S - 2007. Structure, functions, applications.
• Entrez-PubMed

pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological ... Teaching and learning a foreign language at a distance. ...

Еще в разделе: (Показать все результаты (>3) - dist.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр дистанционного обучения.

... Научно-методический совет по иностранным языкам . ... Факультет иностранных языков и регионоведения . МГУ им. М.В. Ломоносова. Центр Дистанционного Образования . ... The Scientific and Methodological Council on Foreign Language Teaching . ... в обучении иностранным языкам и межкультурной коммуникации", . которая состоится 7-8 июня 2006 г. на базе . факультета иностранных языков и регионоведения . ... Дидактические принципы дистанционного обучения иностранным языкам; . ...

Еще в разделе: (Показать все результаты (>10) - anazarenko.ffl.msu.ru/ )

The Department of Talented Youth Affairs and Professional Orientation . ... Older posts . Posted on 09.11.2015 by admin . ... The team competitions Continue reading . Posted in News , Без рубрики | Leave a comment . ... In the 2015/16 Continue reading . ... The festival is organized by the Department of Continue reading . ... Posted on 17.11.2014 by admin . ... Federal Agency for Youth Affairs ?Rosmolodezh?, ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>45) - talant.msu.ru/ )

• News | The Department of Talented Youth Affairs and Professional Orientation |

Veronika K. Laurinavichute . ... Selected papers . ... Electrochemistry and electrochromic properties of polyoxometataltes . ... N. V.Titova, V. K. Laurinavichute, Z. V. Kuminova, G. A. Tsirlina. ... Chem. Phys., 2008, Vol. 352, Iss. ... Vassiliev, G. A. Tsirlina. ... Kotov, A. F. Gordova, Yu. ... S. Vassiliev, V. Laurinavichute, A. Abakumov, E. Bendovskii, A. Filatov, D. Simakov, A. Gusev, E. Antipov, G. Tsirlina, Electrochemistry of Tin-Species in Mid Temperature Cryolite-Alumina Melt. ...

Еще в разделе: (Показать все результаты (>93) - electr003.chem.msu.ru/ )

• Pronkin Sergey Nikolayevich
• Boris B. Damaskin
• Evgeny V. Antipov:CV

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>572) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: American Association of University Woman
• Клуб выпускников МГУ: Обсуждение материала "American Association of University
• Клуб выпускников МГУ: Конференция "Выпускники ВМиК"

THE STRUCTURES OF TIME. ... The essence of time is considered in the observing of the present, which is the attribute of united existence. The time is considered as the self-organizing reality, the elements of which are determined as the structures of time. ... 272]. ... B , , , 11-05, , , , 11-10 (, , , 5 ). ... 272ґ274]. ... 273]. , ? ... 1986. ... 1979. ... 2003. 3. , . ... 2. der Zweifel . ... 1999. ... http://www.chronos.msu.ru/ 7. ? , ? ґ ?? . ... 1996. 10. http://ru.wikipedia.org/wiki 11. ...

Еще в разделе: (Показать все результаты (>463) - chronos.msu.ru/ )

• The Finite and the Infinite: A New view on the problem
• A. P. LEVICH, A. V. SOLOV?YOV. CATEGORY-FUNCTOR MODELLING OF NATURAL SYSTEMS
• Russian Interdisciplinary Temporology Seminar

... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...

Еще в разделе: (Показать все результаты (>53) - geophys.geol.msu.ru/ )

... Географии мирового хозяйства . ... Выберите кафедру . ... Кафедры . ... Учебно-научные базы . ... РЖ "Вестник МГУ", сер." ... РЖ "Geography, Environment, Sustainability" . ... Учебно-методический отдел . ... Кафедра географии мирового хозяйства . Кафедра геохимии ландшафтов и географии почв . ... Кафедра социально-экономической географии зарубежных стран . ... НИЛ возобновляемых источников энергии . ... Редакция журнала "Geography, Environment,... journal GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY . ...

Еще в разделе: (Показать все результаты (>401) - www.geogr.msu.ru/ )

• Сергей Сергеевич Зилитинкевич
• Вестник Московского университета. Серия 5. География
• hmokn

... О факультете . ... Master In Ecology . Master In Nanobiotechnology . ... Nanobiotechnology and Biophysics? is intended for prospective highly qualified professionals with in-depth knowledge in of modern biophysics, molecular biology and nanobiotechnology. ... The program is focused at problems of modern nanobiotechnology, biophysics and proteomics, and hence it consists of the two parts: lectures/seminars and laboratory work. ... Lectures / Practical . ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>5) - www.bio.msu.ru/ )

• Master In Ecology ? Биологический факультет МГУ

... Форумы > Аспирантура > Тема . ... Аспирантура в Порту, Португалия . ... Grant call on E-Careers site: . ... Research Grant . ... Position/ Grant: PhD Research Grant. Generic scientific area: Engineering. ... Location: University of Porto, Faculty of Engineering, Department of Informatics Engineering (FEUP-DEI), http://www.fe.up.pt . ... This PhD research grant requires the completion of a PhD at the Department of Informatics Engineering, Faculty of Engineering, University of Porto (FEUP-DEI). ...

Еще в разделе: (Показать все результаты (>200) - www.mmonline.ru/ )

• Програма конферецнии Topology, analysis and applications in mathematical
• ММПриколы. Часть 3
• MMOnline | Новости | Програма конферецнии Topology, analysis and applications

... Optical-Acoustic Spectroscopy of Structural Changes in Metals Under Shock Loading . ... The results of experimental investigations of metal structure changes by a optical.acoustic spectroscopy method are submitted. Iron and nickel samples subjected to vacuum annealing at different temperatures were investigated. ... In samples with the different grain size the plastic deformation in a loading zone leads to reorganization of structure completed at different scale levels. ...

Еще в разделе: (Показать все результаты (>202) - acs366.phys.msu.su/ )

• Schedule : Nonlinearity of Media and Structures, Nonlinear Testing
• Abstract (Invited)

... Mean curvatures of stationary random sets and associated random fields." ... The core of the method is the estimation of morphological image characteristics combined with asymptotic Gauss tests of their distribution. We introduce estimators for the specific intrinsic volumes (comprising the volume fraction, the specific surface area and the Euler-Poincare characteristic (porosity)) of stationary random closed sets by estimating the mean of associated random fields. ...

Еще в разделе: (Показать все результаты (>76) - new.math.msu.su/ )

• http://new.math.msu.su/Sites/demosite/Uploads/abstractsm50.58D32DCEDD634CB0AA8244EDE617F1DB.pdf
• Официальный сайт механико-математического факультета МГУ имени М.В.Ломоносова

... FPGA design, architecture, means and methods of work. ... FPGA stands for Field-Programmable Gate Array, which is a semi-conductive crystal, the connections between gates of which and the logic of work can be modeled and changed repeatedly during its work. ... Each semester has 12 obligatory classes of four (4) academic hours each once a week, which totals in 48 hours per semester. ... In spring semester students have 44 hours to work on their term papers on design and then 4 hours for defending...

Еще в разделе: (Показать все результаты (>18) - engineering.phys.msu.ru/ )

• Microcontroller Programming
• Parallel Programming

i 1 Summar y of 3 P3 "Simulations and Computations in Theoretical Physics and Phenomenology": -- Automated Calculation and Simulation Systems -- Thorsten Ohl и -- Universitat Wurzburg -- и ohl@physik.uni-wuerzburg.de ACAT 2002, Moscow State University, June 28, 2002 Th. ... Status and Trends at ACAT 2002 . ... Ohl Automatic Calculation Systems ACAT 2002 Mission Fully automated calculation and simulation systems in par ticle physics aim to produce model parameters process e. g. cuts L m, g, . ...

Еще в разделе: (Показать все результаты (>56) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/konash/Slides_ACAT2002.doc
• http://acat02.sinp.msu.ru/presentations/severyanov/Severyanov-poster.ps
• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-06-ResourceManagement1.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• StructAlign help
• Align tool for DNA-protein complexes

Magnetism Department MSU . ... Research groups . ... Students . Phd students . ... The basics of spintronics. prof . Vedyaev ю. Actual problems in modern magnetism . prof . Granovsky A. The physical basics of magnetism . associate prof . Kotel'nikova O. Magnetic phase transitions. associate prof . Kotel'nikova O. Physics of magnetic phenomena. associate prof . Kotel'nikova O. Introduction in group theory and its application in physics of magnetic phenomena. associate ...

Еще в разделе: (Показать все результаты (>26) - magn.phys.msu.ru/ )

Third Harmonic Generation in Fishnet Metamaterials M. R. Shcherbkov1, J. Reinhold2, A. S. Shorokhov1, A. Chipouline2, C. Helgert2, T. Pertch2, A. A. Fedyanin1 1 Faculty of Physics, Lomonosov Moscow State University, 119991 Moscow, Russia 2 Friedrich-Schiller-UniversitДt Jena, 07743 Jena, Germany shcherbakov@nanolab.phys.msu.ru Abstract: Optical third harmonic generation in gold-based fishnet metamaterials is studied. ...

Еще в разделе: (Показать все результаты (>75) - nanolab.phys.msu.ru/ )

• Students can now use the homework download system and track their current

Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...

Еще в разделе: (Показать все результаты (>2) - statsoft.msu.ru/ )

... Leading Research Associate (MSU) . ... Graduated from the Moscow State University, 1960 . PhD, Moscow State University, 1970 . Doctor of Sciences, Moscow State University, 1995 . ... Type of Research: experiment . Research Interests: . ... Graduated from the Moscow Institute of Chemical Technology, 1954 . PhD, Moscow Institute of Chemical Technology, 1958 . Doctor of Sciences, Moscow Institute of Chemical Technology, 1981 . ... Type of Research: experiment, theory . ...

Еще в разделе: (Показать все результаты (>4) - newcryst.phys.msu.ru/ )