... Head of the Innovation Policy and Innovation Project Management Department . ... Doctor of Biology (1987), Full member of the Russian Academy of Science (1997), Professor, Head of the Biological Engineering Department at the Faculty of Biology (2000), Head of the Protein Engineering Laboratory of the Bioorganic Chemistry Institute of the Russian Academy of Science (2002), Pro-Rector - Head of the Innovation Policy and Innovation Project Management Department (2004). ...

Еще в разделе: (Показать все результаты (>57) - www.msu.ru/ )

• FACULTY OF PSYCHOLOGY
• INSTITUTE OF ASIAN AND AFRICAN STUDIES
• Bachelor studies

... Professor Yurii Naumovich Lipsky oversaw the preparation of the first ever maps of the far side of the Moon, of the whole Moon, and cartographic globes of the Moon. ... He was a professor, a doctor of physico-mathematical sciences, the founder of the Department of Lunar and Planetary Physics in GAISh and its first head. ... The first photographs of the far side of the Moon . ... He was the scientific supervisor of the study of the first photographs of the far side of the Moon. ...

Еще в разделе: (Показать все результаты (>61) - selena.sai.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>6) - www.chemport.ru/ )

• Real estate market monitoring november 2010 ипотечные ценные бумаги ставки

... GEOCHEMISTRY Vertical Structure of the Aganozero-Burakovsky Layered Massif and Distribution of Major Elements in Its Section. ... Uritskogo 65, Petrozavodsk, 185030 Russia **** Department of Geology and Geophysics, University of Minnesota, 108 Pillsbury Hall, 310 Pillsbury Drive S.E., Minneapolis, MN 55455, USA Based on petrographic study and distribution patterns of major elements, the standard section was divided into upper and lower contact zones, and layered series (Ucz, Lcz, LS). ... 3 1996 ...

Еще в разделе: (Показать все результаты (>297) - geo.web.ru/ )

• Informal geological society
• Вторая находка в мире архейских офиолитов! - Все о Геологии (geo.web.ru)

... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...

Еще в разделе: (Показать все результаты (>12) - www.issp.ac.ru/ )

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>194) - www.philol.msu.ru/ )

• II International Congress of Russian Language Researches - Information letter

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>36) - srcc.msu.ru/ )

• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial
• Semikoz V. B., Sokoloff D., Valle J.W.F. Lepton asymmetries and primordial

... Interface description . ... 6 Distributed array creating and deleting . ... 13.4 Access to elements of local part of distributed array . 13.4.1 Requesting if array element is allocated in local part of distributed array . ... 13.4.5 Coping element of local part of distributed array to element of local part of other distributed array . 13.4.6 Requesting address of element of local part of distributed array . ... 14.5 Access to distributed array elements, allocated in remote element buffer . ...

Еще в разделе: (Показать все результаты (>99) - sp.cs.msu.ru/ )

• Lib-DVM. Interface description. Part 5 (14-15)
• DVM debugger. Detailed design. Part 4
• Lib-DVM. Interface description. Part 4 (12-13)

... Начало www.99ru.ru Другое 6242 . ... Введите код товара из каталога. автор 1984 . ... 6242 . 1984 . ... Brick 2 x 4 Красный 8 X Brick 2 x 4 Синий 2 X Train Weight 2 x 6 x 2 - bottom openings, center seam on short sides Красный 24 X Technic , Brick 1 x 2 with Hole Красный 24 X Technic , Brick 1 x 2 with Hole Синий 24 X Technic , Brick 1 x 4 with Holes Синий 16 X Technic , Brick 1 x 4 with Holes Красный 4 X Technic , Brick 1 x 6 with Holes Синий 4 X Technic , ...

Еще в разделе: (Показать все результаты (>27) - www.bukivedi.ru/ )

Volume 163, number 2 FEBS 0973 November 1983 Diazepam inhibits cell respiration and induces fragmentation of mitochondrial reticulum Ivan A. Vorobjev and Dmitry B. Zorov A.N. Belozersky Laboratory of Molecular Biology and Bioorganic Chemistry, Moscow State University, 117234 Moscow, USSR Received 1 August 1983; revised version received 14 September 1983 Diazepam (70-150 µg/ml) significantly inhibits oxygen consumption by pig kidney embryo cells and causes the cellular ATP level to fall. ...

Еще в разделе: (Показать все результаты (>31) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/amchencova98.pdf
• http://cellmotility.genebee.msu.ru/html/articles/Alieva04.pdf
• http://cellmotility.genebee.msu.ru/html/articles/uzbekov96.pdf

... Navier-Stokes Based Models in Computational Aeroacoustics . ... The same high accuracy numerical scheme is proposed for the numerical implementation of all the models. It is illustrated that a good efficiency of predictions is provided not only by the scheme accuracy, but also by such computational properties as differential model accuracy and round off errors. The following particular aspects are discussed: the influence of nonlinear effects and the treatment of very small perturbations. ...

Еще в разделе: (Показать все результаты (>397) - acs366.phys.msu.su/ )

• General Information

... MSU's HPC HISTORY . ... 2.5PF "LOMONOSOV-2" . 1.7PF "LOMONOSOV" . ... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Performance System Analysis . ... Former Russian President Dmitry Medvedev and the President of Moscow State University Victor Sadovnichy at the Lomonosov supercomputer presentation . т??Lomonosovт?? supercomputer was installed at the Moscow State University in 2009. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>20) - hpc.msu.ru/ )

• Supercomputing Education Project | Moscow University Supercomputing Center
• Nationwide Supercomputing Education Project | Moscow University Supercomputing
• MSU's HPC HISTORY | Moscow University Supercomputing Center

Graduated from Chemical Department, Moscow State University (1997), senior research fellow at Department of Electrochemistry , Chemical Faculty, MSU. ... since 2000 - research fellow at Department of Electrochemistry , Chemical Faculty, MSU. ... PhD thesis: The structure of platnium nanocatalysts and their electrochemical properties , completed June 2000 . ... 2001 - Research fellowship of Alexander von Humboldt foundation . ... Electrochemistry and in situ STM of heteropolyoxometallates on Au(111) . ...

Еще в разделе: (Показать все результаты (>47) - electr003.chem.msu.ru/ )

• Galina A. Tsirlina: Eduard L. Nagaev. Scientific heritage

... До 1 ноября Springer предоставляет бесплатный доступ к более чем 150 математическим журналам . From today to November 1, 2006: Enjoy free access to all journal issues back to 1869. Get exclusive, unlimited access to more than 150 journals, including: . ... Mathematische Annalen . Mathematische Zeitschrift . ... Read and download any article from the complete archive of all journals including classics like Acta Mathematica and Mathematische Annalen dating back to the 19th century. ...

Еще в разделе: (Показать все результаты (>90) - www.mmonline.ru/ )

• MMOnline | Форумы | Первокурсникам | Си - полезная информация
• MMOnline | Новости

... Sunday, November 4, 2007 |4:30 - 6:30pm |Flight SU #303 arrives to |Pickup at Pearson Int'l Airport | ... 8:00 - 10:00pm |Dinner |Executive Dining Room | Monday, November 5, 2007 |7:00 - 9:00am |Breakfast |Executive Dining Room | ... Tuesday, November 6, 2007 |7:00 - 8:00am |Breakfast |Executive Dining Room | ... 12:30 - 1:30pm | ... Wednesday, November 7, 2007|7:00 - 9:00am |Breakfast |Executive Dining Room | ... Thursday, November 8, 2007 |7:00 - 9:00am |Breakfast |Executive Dining Room | ...

Еще в разделе: (Показать все результаты (>2) - www.innovation.msu.ru/ )

... November, 2005 . ... Moscow State University Russian Language Centre . ... Learn Russian at the Moscow State University! On November, 18th at Session of Advice of academic councils of the Moscow State University by ballot by the rector on the following five years have been selected Victor Antonovich Sadovnichy. (more.. ... Cinema lovers from across France and beyond are converging on the sea resort of Honfleur in Normandy to get a glimpse of contemporary Russian cinema (more.. ...

Еще в разделе: (Показать все результаты (>7) - www.rlcentre.com/ )

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>2) - bioinf.fbb.msu.ru/ )

Krejnes, M. A., Morozova E. A., Chentsov, N. N. XIII Moscow School Mathematical Olympiad. Uspekhi Mat. Nauk 5 (1950), No. 5 (in Russian). ... Congress 2 (1956) (in Russian). ... Mat. ... Morozova, E.A., Petrakov, I. S. International Mathematical Olympiad (completed 2-nd publication). ... Morozova, E.A., Petrakov, I. S., Sevorcov, V. A. International Mathematical Olympiad (completed 4-nd publication). ... Morozova, E. A., Chentsov, N. N. Matrices of probabilities and stochastic supermatrices. ...

Еще в разделе: (Показать все результаты (>120) - higeom.math.msu.su/ )

• Conferences (English)
• Topology section
• Alexey Garber (Russian)

... Предыдущее сообщение: PARALLEL.RU - Новости, специальный выпуск [16/11/2010] . ... Выпуск 298 . 23 ноября 2010 г. ------------- 1 декабря 2010 заканчивается срок представления аннотаций докладов на Международную научную конференцию Параллельные вычислительные технологии (ПаВТ) 2011 . http ://agora.guru.ru/pavt ------------- На странице Научного семинара PARALLEL.RU выложены ссылки на видеозапись выступления Томаса Стерлинга в НИВЦ МГУ имени М.В.Ломоносова 1 ноября 2010 года ...

Еще в разделе: (Показать все результаты (>10) - mail.parallel.ru/ )