... Loke's and Barker's "deconvolution" idea is to represent the cross-section under the VES observation line by a set of 2D blocks with fixed boundaries and certain initial values of blocks' resisitivity. ... The TRF_2D for Windows program processes the traverse of VES with current line along the observation line. Three arrays date can be processed: . ... Up to 100 sounding points on the observation line. Up to 20 arbitrary current electrode spasings per sounding point. ...

Еще в разделе: (Показать все результаты (>13) - geophys.geol.msu.ru/ )

... О UNИX . ... Homework_TrigonPea . Неизменяемая страница . ... Trigon , обозначающий треугольник: . ... Неравенство треугольника проверять не надо. t=mod.Trigon(3,4,5) p=mod.Pea(3,4,5) z=mod.TrigonPea(3,4,5) print "{:.6f}".format(t.square()) print "{:.6f}".format(t.perimeter()) print "{:.6f}".format(p.square()) print "{:.6f}".format(z.volume()) print "{:.6f}".format(z.square()) . ... LecturesCMC/PythonIntro2014/Homework_TrigonPea (последним исправлял пользователь FrBrGeorge 2014-11-30 23:30:56) . ...

Еще в разделе: (Показать все результаты (>9) - uneex.mithril.cs.msu.su/ )

• LecturesCMC/PythonIntro2014/09_ClassesInheritance - UNИX
• FrBrGeorge/ClassesInPython - UNИX

... Bibliography . ... Technical report, IBM T. J. Watson Research Center, October 1992. ... IEEE Computer , 26(6):88--95, June 1993. ... The Argonne/GMD macros in FORTRAN for portable parallel programming and their implementation on the Intel iPSC/2. Parallel Computing , 15:119--132, 1990. ... Technical Report TM-ANL--92/17, Argonne National Laboratory, 1992. ... Parallel Computing, Special issue on message--passing interfaces , to appear. ... Technical Report 91-12, Dept. ... Центры . ...

Еще в разделе: (Показать все результаты (>67) - www.parallel.ru/ )

• The History of the Development of Parallel Computing | PARALLEL.RU -

. Новости 2008 John Smith Fellowship Programme . Главная . Новости . Учеба в МГУ . Обмены . Контакты . Поиск . Извините, но для просмотра этой страницы у Вас недостаточно прав. Вы должны авторизоваться или пройти регистрацию. По вопросу доступа сотрудников МГУ к закрытым разделам сайта обращайтесь к А.В.Киташову . Московский государственный университет им. М.В.Ломоносова . Управление международного сотрудничества 2007-2008

Еще в разделе: (Показать все результаты (>2) - www.ied.msu.ru/ )

CONTENTS Elena Trubina The Canonical and the Valuable: Challenges of Variety and Difficulties of Translation Cultural Exchange as Problem |Steven |Making Comparisons: First Contact,| ... Translation by | ... Values and Canons |Barbara |Contingencies of Value. Herrnstein |Translation by A. Bogdanova | ... Anna |The Western Canon through Edward | ... Maria |Canonical Text as a Means of | ... Values in Text |Vladimir |Cultural Axioms in Language | ... Elena Lapteva|Value and Price: The Problem of | ...

Еще в разделе: (Показать все результаты (>68) - www.philol.msu.ru/ )

... 1994 , 1950. 4 5 6 22 2: q1 = Ѕ, p1 = ѕ () 7 8 9 10 ­ . ... 2.2) G J f j j J ; ) 0 0 { t 0 } G; ) G , (2.2). lim t t 0 16 () S . ... s fers ( , N ) , , s ( , N ) , N . ... 70% («World population prospects», 1996). 31 ? ... s a , z , u0a , , : 1) ( u1a ), 2) ( u2a ), 3) , ( u a , j 3, 4, ... , , j ). s a , . u a ( s a , z ) wia ( z ) min i i , a : o wia - uia , o ia - . ... 2050 . ... UN 2050 population forecast»). , . ... o 1990 1994 .: 11 15.7 ( ), 1.9 , ­ 3.5 , ­ 2.3 , ­ 1.7 , ( ) ­ 3 . ...

Еще в разделе: (Показать все результаты (>3) - www.soc-phys.chem.msu.ru/ )

... Cancellation policy for all excursions: The cancellation of the tours before May 22, 2013 - no penalty. ... Time : will be announced soon . The price includes : transfer Moscow-Suzdal-Moscow, 1 night accommodation, meals according to the program, entrance tickets, English speaking guide. Suzdal is a calm old Russian town situated 220 km north-east of Moscow, 38 kilometers north from the city Vladimir, on the Kamenka river. ... Tour program: . ... Excursion to State Tretyakov Gallery . ...

Еще в разделе: (Показать все результаты (>3) - iconolat13.phys.msu.ru/ )

• Housing and travel

... GOTO 100 0038 IF(ALFA.EQ.0.) ... EPS)GOTO 2 0054 IF(ALFA.EQ.0.) ... GOTO 68 0075 K2=K2+1 0076 IF(K2.EQ.IMAX) GOTO 67 0077 X0=Y 0078 F0= AN4 0079 GOTO 23 0080 37 CONTINUE C * changing the interval 0081 X=Y 0082 F= AN4 0083 GOTO 23 0084 ENTRY PTIPRE C * entry to continue calculations 0085 ICONT=1 0086 GOTO 110 0087 64 CONTINUE C * working array is too short 0088 IERR =64 0089 GOTO 9999 0090 65 CONTINUE C * initial regularization parameter is too small 0091 IERR =65 0092 ...

Еще в разделе: (Показать все результаты (>9) - foroff.phys.msu.ru/ )

• http://foroff.phys.msu.ru/illposed/programs/Fig4_11.txt
• http://foroff.phys.msu.ru/illposed/programs/Fig4_7.txt
• http://foroff.phys.msu.ru/illposed/programs/Fig4_8.txt

Nosov Valentin A. (Moscow State University) Constructing a Parametrical Families of Latin Squares in the Bo olean Database. ... In this article the construction of parametric classes of Latin Squares over Bo n-vectors is demonstrated so that these Latin Squares are represented in analytical by families of Boolean functions. ... Let En -- the set of binary vectors of dimension n. In this case Latin Square over set En may be determined by family of n Boolean functions f1 (x1 , . ... gn ) is proper. ...

Еще в разделе: (Показать все результаты (>15) - www.intsys.msu.ru/ )

• Intelligent Systems :: Magazine :: Web archive :: Volume 12, issue 1-4, 2008
• Интеллектуальные системы :: Журнал :: Архив выпусков :: Том 12, выпуск 1-4,

... 8-915-053-98-34, e-mail: stitova3@gmail.com URL: http://mobithinking.com 2 , 199 . ... URL: http://www.smart-edu.com/index.php/statie-learning/e-learning-v-rossii-%E2%80%93-itogi-2010-i-zadachi-na-2011.html Attewell J. Mobile Technologies and Learning: a technology update and m-learning project summary. ... URL: http://www.aupress.ca/index.php/books/120155 Savill-Smith C., Attewell J., Stead G. Mobile Learning in Practice: Piloting a mobile learning teachers' toolkit in further education colleges. ...

Еще в разделе: (Показать все результаты (>17) - ffl.msu.ru/ )

• http://www.ffl.msu.ru/research/avtoreferats/19-grinkevich_avtoreferat_06.doc

... 4) Percolation probability: [pic] , where L is linear size of lattice. ... The presence of obstacles in a system leads to: - increase of the critical concentration value; this effect grows with increase of the full area of obstacles and falls with increase of the linear size of ones. - increase of the critical exponent ( value; this effect increase with growth both of linear size of obstacles and of their full area. - increase of the growth rate of ...

Еще в разделе: (Показать все результаты (>17) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/fruehwirth/talk.pdf
• http://acat02.sinp.msu.ru/accomod.html
• http://acat02.sinp.msu.ru/presentations/waltenberger/Robust.pdf

... 2009/2010 . ... 2009 , 1 / 11 1 const C++ 2 . ... 2009 , 2 / 11 -- ( ) &_ = ; , . ... 2009 , 3 / 11 -- #i n c l u d e < i o s t r e a m > u s i n g namespace s t d ; i n t main ( ) { int i = 42; i n t &r e f _ i = i ; ++ i ; c o u t << " i : " << i << e n d l ; c o u t << " r e f _ i : " << r e f _ i << e n d l ; ++r e f _ i ; c o u t << " i : " << i << e n d l ; c o u t << " r e f _ i : " << r e f _ i << e n d l ; system ( " pause " ) ; return 0; } . ... 2009 , 7 / 11 double Square(double x), . ...

Еще в разделе: (Показать все результаты (>2) - ani.cmc.msu.ru/ )

• http://ani.cmc.msu.ru/files/geo-2009-prac-05.pdf

HOTEL ACCOMMODATION IN MOSCOW We are glad to offer the accommodation for the conference participants in the following hotels. ... Breakfast: buffet table Price: Single room ­ 120 euro Single room comfort ­ 130 euro Double room ­ 140 euro Check-in 12:00, check-out 12:00 DEADLINE for booking and making payment is 1 May 2007 HOTEL Holiday Inn Lesnaya 4**** Address: Moscow, Lesnaya st., 15 Location: The Holiday Inn Moscow Lesnaya hotel is ideally located for both the business and leisure travelers. ...

Еще в разделе: (Показать все результаты (>38) - www.enzyme.chem.msu.ru/ )

• http://www.enzyme.chem.msu.ru/bc2007/Social_program.pdf
• http://www.enzyme.chem.msu.ru/ryabov/pdf/MC_97.pdf

... car ( ) . ... d e f in e (d ef in e ( y-co ord x) (x -co o r d x ) (t ru n c a t e ( c a d r x ) )) (tru n cate ( car x ))) ( d ef i n e nod es ' ( (nl (n2 (n3 (n4 (n5 ( (n7 (n8 (n9 (n l 0 ( nil ( 60 402 ) ) ( 50 3 1 0) ) (110 60) ) ( 220 375) ) ( 1 92 220 ) ) (260 4 4 ) ) ( 305 300 ) ) (347 404)) ( 3 5 1 262 )) (4 0 0 11 ... n2) ( n 2 n3) ( n3 n 5 ) ( n n 6 ) ( n 6 nl 0) ( n9 nl 0) ( n 7 n9) ( n l n 4 ) ( n 4 n 2 ) ( n 5 n8) (n 8 n 4 ) (n 7 n i l ))) ( define (init-l engths pat hlist) (let (...

Еще в разделе: (Показать все результаты (>15) - sp.cs.msu.ru/ )

... Belozersky Institute . ... Fasta3 at EBI, United Kingdom . ... EFETCH : quick database entry retrievial (by entry name or accession number) at Institute Pasteur ( advanced form ) . Alignment: . ClustalW Multiple Sequence Alignment at EBI . ClustalW ( advanced form ) at Institute Pasteur . ... Global multiple alignment (Bio-lirmm, France) . ... Service at EMBL (Germany) . Service at EBI (United Kingdom) . Service at Institute Pasteur (France) . Service at ExPASy (Switzerland) . ...

Еще в разделе: (Показать все результаты (>40) - www.genebee.msu.ru/ )

• science

... 82, No. 10, pp. 1901­1917, 2010. doi:10.1351/PAC-CON-09-10-22 © 2010 IUPAC, Publication date (Web): 6 August 2010 Hydrated metal ions in aqueous solution: How regular are their structures? ... The hydrated tin(II), lead(II), and thallium(I) ions are hemi-directed in aqueous solution, while the hydrated bismuth(III) ion is holo-directed. ... 5 Schematic illustration of the bond strength of the capping water molecules of the hydrated lanthanoid(III) ions in aqueous solution in the four tetrads. ...

Еще в разделе: (Показать все результаты (>18) - electr003.chem.msu.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... advanced search), , . author search). ... 3 SCOPUS, , . ... source title), (author name), (year), (document t ype) (subjec t area). . ... author search) SCOPUS (, `Smith, J.' `Smith, J.', `Smith, Johan' `Smith, J.L.'). ... search aler ts). ... My Aler ts) , (search aler ts), (document citation aler ts). : 1 2 2. · · · · · : , - , : usinfo @ scopus.com b r i n f o @ s c o p u s .c o m n l i n f o @ s c o p u s .c o m sginfo @ scopus.com jpinfo @ scopus.com w w w.info.scopus.com /users RU 02 / 05 ...

99. Hotel "69 Parallel" - Main

100. Cultural Programmes and Excursions :: Academic Programmes :: CIE