In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>9) - bioinf.fbb.msu.ru/ )

• SDPpred

SITE 2010 Comprehensive Characterization of Astronomical Sites Kislovodsk, Russia, 49 October 2010 Conference Summary Marc S. Sarazin*a a European Southern Observatory, Garching, Germany Abstract The main topics discussed during the Site 2010 conference are outlined and the outcome is described. Keywords: Astronomical Site testing, precipitable water vapor, atmospheric turbulence, cloudiness, seeing 1. ... Site surveys for National observatory projects in China, India, and Iran benefit from this. ...

Еще в разделе: (Показать все результаты (>22) - site2010.sai.msu.ru/ )

... Grant of Ministry of Science and Techologies of Russian Federation, subprogram "Engineering enzymology . ... The development of fundamentals and technology of sulfur removal from gas and waste water streams by immobilyzed biocatalytic systems . ... Grant of Ministry of Science and Technologies of Russian Federation subprogram "Biocatalytic technologies " . Ministry of Science and Technologies of Russian Federation . ... Grant of Ministry of Science and Technologies of Russian Federation . ...

Еще в разделе: (Показать все результаты (>116) - www.enzyme.chem.msu.ru/ )

... Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr. ... Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. <div class="myclass">...</div> . ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna. ...

Еще в разделе: (Показать все результаты (>8) - physcontrol.phys.msu.ru/ )

• List All Categories

О лаборатории . ... Лаборатория теоретической биофизики . ... On this page we collect references to our resources, documentation and resources on other sites. All these data are very helpful for everybody who wants to learn practical quantum chemistry. Firefly (PC GAMESS) main page . ... ERG group wrote some articles about visualization: . ... Нет комментариев " Quantum chemistry information page " . ... Quantum chemistry information page . ... 2015 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>58) - erg.biophys.msu.ru/ )

• comcon1 ERG Research Group: Лаборатория теоретической биофизики
• OPLS-AA patch for different types of molecules ERG Research Group: Лаборатория
• Reaction-diffusion systems in 2D space with python ERG Research Group:

CALL for PAPERS . September 29-October 2, 2005 Boston University, Boston, Massachusetts, U.S.A. The Central Eurasian Studies Society (CESS) invites PAPER and ROUNDTABLE proposals for the Sixth CESS Annual Conference, September 29-October 2, 2005, in Boston, Massachusetts. ... Paper and roundtable proposals relating to all aspects of humanities and social science scholarship on Central Eurasia are welcome. ... Deadline for Submission of Paper and Roundtable Proposals: April 1, 2005. ...

Еще в разделе: (Показать все результаты (>124) - www.prof.msu.ru/ )

• Training For Effective Intercultural Communication
• A Unique Opportunity for Young Americans and Russians to Volunteer Abroad!
• INTERNATIONAL FULBRIGHT SCIENCE AND TECHNOLOGY AWARDS

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>129) - hist.msu.ru/ )

• "Novaya i noveishaia istoria" Journal

... Randles impedance. Interfacial capacitance. ... Partial currents ik in the bulk solution are determined by transport numbers tk . ... dl Thermodynamics of interfaces ґ binary solution : 2 independent variables, e.g. = +/z+ - -/zsolution: dE+ = ( Cdl )-1 d - t -dl d(/F) d+ = - t+dl d - Cdl d(/F) EDL: + , d- = - t -dl d + Cdl d(/F) metal : THREE independent interfacial parameters: (1) Cdl , interfacial capacitance ( capacitance of the electrical double layer ), (2) t+dl et t-dl , ...

Еще в разделе: (Показать все результаты (>66) - electr003.chem.msu.ru/ )

• Laboratory of Electrochemical energetics
• Boris B. Damaskin

... D.V. Khmelev in [] has offered and tested statistically a technique giving correct predictions with quite a high probability. ... To the best of our knowledge, first attempts in the search of technique for author authorship attribution was given in []. ... The matrices of transition frequencies of element (letter, grammatical code, etc) pairs are calculated over all texts of each author. ... In Appendix written by D.V. Khmelev, another approach to authorship attribution is presented. ...

Еще в разделе: (Показать все результаты (>52) - old.philol.msu.ru/ )

• Using Literal and Grammatical Statistics\\ for Authorship Attribution

... Two-dimension linear regression model. ... The econometric modeling of time series . ... The course aims to provide students with basic models and methods of econometric modeling of financial time series. ... The course considers in detail the major methods of econometric modeling of time series, in particular modeling by stochastic processes, modeling of stationary and non-stationary time series, the spectrum analysis of time series. ... The problem of tax optimization under a given state budget. ...

Еще в разделе: (Показать все результаты (>17) - io.cmc.msu.ru/ )

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>17) - hcs.cmc.msu.ru/ )

• Master program "Decision Engineering in Economics and Finance" | Магистерское и
• Master Education | Магистерское и послевузовское образование Entrance
• Master program "Enterprise Information Systems" | Магистерское и послевузовское

... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

Еще в разделе: (Показать все результаты (>2) - scon155.phys.msu.ru/ )

... REVIEWS Measurement and Physical Content of Quantum Information B. A. Grishanin and V. N. Zadkov Received January 15, 2002 Abstract--Basic quantum information measures involved in the information analysis of quantum systems are considered. ... But today, it has become possible to intentionally vary directly quantum states of elementary quantum systems. ... 9 2002 MEASUREMENT AND PHYSICAL CONTENT OF QUANTUM INFORMATION 935 its information-equivalent copy is at the input and output. ...

Еще в разделе: (Показать все результаты (>71) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/SPIE-5128-37-46(2003).pdf
• http://qilab.phys.msu.ru/papers/SPIE-2370-414-424(1995).pdf
• http://qilab.phys.msu.ru/papers/SPIE-4750-54-63(2002).pdf

... Форумы > Аспирантура > Тема . ... Аспирантура в Порту, Португалия . ... Grant call on E-Careers site: . ... Research Grant . ... Position/ Grant: PhD Research Grant. Generic scientific area: Engineering. ... Location: University of Porto, Faculty of Engineering, Department of Informatics Engineering (FEUP-DEI), http://www.fe.up.pt . ... This PhD research grant requires the completion of a PhD at the Department of Informatics Engineering, Faculty of Engineering, University of Porto (FEUP-DEI). ...

Еще в разделе: (Показать все результаты (>134) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | PhD position in the University of Florida

MAPS AND GLOBES OF THE MOON COMPILED WITH PARTICIPATION OF THE DEPARTMENT OF LUNAR AND PLANETARY INVESTIGATION J.F.Rodionova, Sternberg State Astronomical Institute Moscow University Resume: A brief description of the mapping of the Moon carried out with the participation of the scientific workers of SAI and with the guidance of Y.N.Lipsky is taken. ... The Globe of the Moon was also issued (the scale 1:13 600 000). ... The CMM map and globe of the Moon were compiled under guidance Y.N.Lipskiy. ...

Еще в разделе: (Показать все результаты (>95) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Symposium/South%20Pole.doc
• http://selena.sai.msu.ru/Symposium/South%20Pole.pdf
• http://selena.sai.msu.ru/Chik/Publications/Aitken/MS015.pdf

... AlgoWiki: an Open Encyclopedia of Parallel Algorithmic Features . ... SIGMA: Collective Bank of Tests on Parallel Computing . ... AlgoWiki is an open encyclopedia of algorithmsтАЩ properties and features of their implementations on different hardware and software platforms, from mobile to extreme scale, which allows for collaboration with the worldwide computing community on algorithm descriptions. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Joint MSU-Intel Center ...

Еще в разделе: (Показать все результаты (>56) - hpc.msu.ru/ )

• APPLICATIONS: Mechanics | Moscow University Supercomputing Center
• Supercomputing Education Project | Moscow University Supercomputing Center
• MSU's HPC HISTORY | Moscow University Supercomputing Center

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• Nhunt: program for nucleic acid sequence similarity search
• ConClus

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>1231) - swx.sinp.msu.ru/ )

• SWX - Космическая погода

... Different domain organization of two main conformational states of Na+/K+-ATPase]. ... The melting curves for the apoforms of Na+/K+-ATPases have different shapes: the curve for the enzyme from the rabbit shows one transition at 56.1 degrees C, whereas the denaturation of Na+/K+-ATPase from the duck is characterized by two transitions, at 49.8 and 56.9 degrees C. Sodium and potassium ions abolish the difference in the domain organization of Na+/K+-ATPases. ...

Еще в разделе: (Показать все результаты (>83) - biochem.bio.msu.ru/ )

• The pivotal role of the beta 7 strand in the intersubunit contacts of different
• Different neuronal Na(+)/K(+)-ATPase isoforms are involved in diverse signaling
• Chaperone-like activity of monomeric human 14-3-3zeta on different protein

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>3) - saistud.sai.msu.ru/ )