Fortran-DVM Compiler . Detailed design . ... 3.1 Parsing . 3.2 Transforming parse tree . 3.3 Generating code in Fortran 77 . ... 4.2 Symbol and Type table . ... This report presents the detailed description of the Fortran-DVM (FDVM) compiler implementation. ... The input to the compiler is source code in Fortran DVM or HPF-DVM language. ... It is designed as an open C++ class library that provides a set of parsers, a structured parse tree, a symbol and type tables for a user. ... dvm.cpp . ...

Еще в разделе: (Показать все результаты (>126) - sp.cs.msu.ru/ )

• DVM-system. Version history
• DVM system - in English
• DVM-system - copyright

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: ?аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>37) - ecfs.msu.ru/ )

• Economic Department | ECFS
• Draft Plan of Action for Eurasian Subregional Partnership | ECFS
• Online Consultation on Network and Partnerships in the area of Food Security |

SELECT data_key, data_value FROM xf_data_registry WHERE data_key IN ('options', 'languages', 'contentTypes', 'codeEventListeners', 'cron', 'simpleCache', 'routesPublic', 'bannedIps', 'styles', 'nodeTypes', 'smilies', 'bbCode', 'displayStyles', 'trophyUserTitles', 'reportCounts', 'moderationCounts') . Run Time: 0.000535 . Select Type . ... Type . ... SIMPLE . ... PRIMARY . ... const . ... library/XenForo/ Autoloader.php . ... library/Zend/Registry.php . ... library/Zend/Db/Select.php . ...

Еще в разделе: (Показать все результаты (>25) - osk.msu.ru/ )

• http://osk.msu.ru/forum/forums/faq.8/?_debug=1
• http://osk.msu.ru/forum/help/bb-codes?_debug=1
• http://osk.msu.ru/forum/members/aaplicagf.1452/?_debug=1

... Published: 30 October 2014 . Science Festival took place in Moscow on October 10-12 2014 . Science Festival include more than 80 different areas. ... Engineering Physics Laboratory demonstrated different robots: balancing robot, LIDAR area scanner, jumping robot Z-Hopper and speech depersonalizer. We also entertain visitors with liquid nitrogen. Everybody could pour it on hands, breathe it and look at the frozen things in nitrogen. ...

Еще в разделе: (Показать все результаты (>72) - engineering.phys.msu.ru/ )

• Circuit Diagnostics

... Выпускники . Выпускники ВМиК . ... Женский клуб . ... Издательство МГУ . ... Конференции . ... Новости для выпускников . МГУ им.Ломоносова . ... База данных выпускников . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... Добавить сообщение . ... Автор: Bambarbia . ... http://www.quantcast.com/tokenizer.org/traffic . ... http://www.tokenizer.org/submitUrl.do . ... Ответить на сообщение . Автор: Funtick . ... Автор: Виктор . ... Funtick пишет 22.01.2007 22:27: . ... Дата: 22.01.2007 22:35 . ...

Еще в разделе: (Показать все результаты (>310) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Senior International Fellows Program
• Клуб выпускников МГУ: International Fellows Program
• Клуб выпускников МГУ: Встреча выпускников МГУ в Канаде (информ. сообщение ?2.5)

The Salzburg Seminar announces American Studies Center Session 27 entitled . RACE, ETHNICITY, RELIGION AND AMERICAN IDENTITY . ... Participants will be sociologists, journalists, and university teachers of American Studies, including historians and literary scholars, who are interested in the ethnic, racial and religious developments that have influenced contemporary American society. ... Also see the Salzburg Seminar website at http://www.salzburgseminar.org and click on American Studies Center. ...

Еще в разделе: (Показать все результаты (>108) - www.prof.msu.ru/ )

• Small grants projects that will be most likely to receive funding?
• The conference "Human Rights in Russia: the past and the present"
• SELF-DISCOVERY, DIVERSITY, FLEXIBILITY AND ACADEMIC EXELLENCE IN THE CONTEXT OF

N owadays, Faculty of Physics includes 7 divisions (experimental and theoretical physics, solid state physics, radiophysics, nuclear physics, geophysics, astronomy, and complimentary education), which fall into 38 chairs. T he faculty?s staff consists of about 1400 employees including faculties, research and technical staff, and administration. Among faculties there are 265 and 235 members with PhD and DrSc (Doctor of Sciences) degrees, respectively, and over 100 full professors. ...

Еще в разделе: (Показать все результаты (>18) - foroff.phys.msu.ru/ )

• Faculty's Tuition Structure
• Your comments about our cite
• Postdoctoral training (General Physics and Wave Processes)

Currently available grants . Exchanges and Training Programs for the NIS . ... The U.S. Department of State's Bureau of Educational and Cultural Affairs (ECA), Office of Citizen Exchanges, is offering a grant opportunity for U.S. organizations to conduct exchanges and training programs in collaboration with partner organizations for the New Independent States. ... Funded by the U.S. Department of State, Program for Research and Training on Eastern Europe and the Newly Independent States. ...

Еще в разделе: (Показать все результаты (>11) - suny.msu.ru/ )

• Center on Russia and the United States :: News

... Academic Programmes . ... Russian Language Programmes . ... A balanced program of speaking, listening, writing and reading skills ensure that all students make progress as quickly as possible. ... Listening/Speaking : you will be able to understand basic instructions or take part in a basic factual conversation on a predictable topic. ... Reading : you will be able to read quickly enough to cope with an academic course, to read the media for information or to understand non-standard correspondence. ...

Еще в разделе: (Показать все результаты (>24) - www.cie.ru/ )

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>179) - www.genebee.msu.ru/ )

• Databases
• Fasta 3.4
• GEA :: Gene Expression Analysis

... Our primary objective is the design and implementation of applied software tools for data processing, output and circulation of computer literature. ... Software tools for signal processing in medicine and engineering CONAN-m and CONAN-t. Statistical stable analysis tool for regression and factor models SIGN. ... Figurnov V.A. "IBM PC for Users" (in Russian). ... Boldin M.V., Simonova G.I., Tyurin Yu.N. "Sign Statistical Analysis of Linear Models" (in Russian and in English ). ... InCo . ...

Еще в разделе: (Показать все результаты (>5) - statsoft.msu.ru/ )

Full-text editions of historical sources . on the history of Russia (in Russian) . on the Internet . ... Collection of electronic resources on history . from the library of historical sources . on our site . ... Library 'Museum of the Decembrists' - documents concerning the Decembrist insurrection of 1825. http://decemb.hobby.ru/ . ... Several sources on Russian history are on a site with documents on the history of Finland. http://www.pp.clinet.fi/~pkr01/historia/history.html . ...

Еще в разделе: (Показать все результаты (>7) - www.hist.msu.ru/ )

• Moscow State University. Faculty of History. Visiting Scholar's Program

Warning : include(menu.php): failed to open stream: No such file or directory in D:\home\host\mse-msu.ru\htdocs\portrait.php on line 3 . ... C:\php\pear') in D:\home\host\mse-msu.ru\htdocs\portrait.php on line 3 . ... Warning : include(footer.php): failed to open stream: No such file or directory in D:\home\host\mse-msu.ru\htdocs\portrait.php on line 139 . ... C:\php\pear') in D:\home\host\mse-msu.ru\htdocs\portrait.php on line 139 . ...

Еще в разделе: (Показать все результаты (>20) - www.mse-msu.ru/ )

... Наука . ... Главная Наука в центре Конференции Наука . ... The 8th European IONS conference is organized by students of Moscow State and Bauman State Technical Universities and will take place from June 21st until June 25th, 2010. ... Dr. James C. Wyant, 2010 OSA President, University of Arizona . ... Student technical talks . ... Manuscript Preparation and Submission by Dr. Rachel Won (Nature Photonics) . ... Lab tours to Moscow State University and Bauman State Technical University . ...

Еще в разделе: (Показать все результаты (>28) - ilc.phys.msu.ru/ )

• Continuing Education and Retraining Program
• "Lasers and nonlinear optics" practical course laboratory
• Practice

... Egor V. Tikhonov Department of Chemistry Moscow State University Leninskie Gory Moscow, Russia,119992 Tel: (095) 939-2086 FAX: (095) 932-8846 e-mail: high_egor@mail.ru . ... Student, Diploma work 'Study of oxidation of PbTe surfaces' . ... Field of interest : surface science, solid state chemistry and physics, synchrotron radiation, semiconductors, crystal growth techniques. ... Тихонов Е.В. Определение лимитирующей стадии роста кристаллов PbSe методом 'пар-жидкость-кристалл'. ... Тихонов Е.В.. ...

Еще в разделе: (Показать все результаты (>28) - www.inorg.chem.msu.ru/ )

• Inorganic Synthesis Laboratory - Supramolecular and Cluster Compounds
• Inorganic Supramolecular Assembl
• Group of Hydrothermal Synthesis :: News

sin, cos, log [1 , N] c 1 . ... for-, , , sizeof. /* beg, beg+step,...,beg+step*(N-1) */ #include <stdio.h> #include <math.h> /* . define N 5 /* , N =10 */ struct Func { char* name; /* double (*fp)( double ); /* } func [] = { { sin , sin { cos , cos { log , log { NULL, NULL }; */ */ }, }, }, } int main() { int beg = 1, /* - step = 1, /* end = beg + (N-1)* step , /* - numfuncs = sizeof( func )/sizeof(struct Func ) - 1; /* func int i; ... sin | ... cos | ...

Еще в разделе: (Показать все результаты (>5) - al.cmc.msu.ru/ )

include stdio.h #include math.h double fdet ( float d, float c, int n ); int fau ( float d, float c, int n, double ua[] ); void fld ( float d, float c, int n, double ld[] ); void fv ( int n, double vld [] ); void main() { int i, i1, j, j1, n = 5 ; float d = 2., c = 1., det ; double ld[ 10 ], ua[100], vld [100]; ...

Еще в разделе: (Показать все результаты (>89) - num-anal.srcc.msu.ru/ )

• Сложно-составные предложения
• БЧА НИВЦ МГУ. Организация Библиотеки. Об использовании версии Библиотеки на Си.

SPAW Editor PHP Edition version 1.0.6 Release Notes Thanks to everyone who downloaded, tried and supported SPAW Editor! This release includes several new features: css classes for tables, background images in tables and table cells, improved link dialog and more. ... If you are fluent in any of languages that are now included and see any typos or mistakes please report to spaw@solmetra.com Happy editing, Alan Mendelevich a.k.a. ailon alan@solmetra.com ...

Еще в разделе: (Показать все результаты (>3) - textbook.sinp.msu.ru/ )

• SPAW Editor documentation

ISSN 1726-3522 . This on-line open access journal is published by the Research Computing Center of Lomonosov Moscow State University . The journal is registered with the Federal Agency for Press and Mass Communications of the Russian Federation as an electronic journal (certificate No. 77-4356, ISSN 1726-3522). The journal is included in the List of Periodicals (in Russian) intended in Russia for the publication of main results of dissertations. ...

Еще в разделе: (Показать все результаты (>130) - num-meth.srcc.msu.ru/ )

• Supercomputer molecular modeling of thermodynamic equilibrium in gas-metal
• "GRID and computational chemistry"
• Numerical simulation of the turbulence development at interaction of an

... Some changes concerning conference fee and social program were caused by financial instability. The Conference Fee is deducted to 200 Euro for foreign participants and includes issue of Official Invitation Letter approved by Russian Emigration Authorities, coffee-breaks and abstract and program books. The reduced Conference Fee is deducted to 1500 Russian rubles for participants from Russia and includes coffee-breaks and abstract and program books. ...

Еще в разделе: (Показать все результаты (>43) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University
• University Satellites and Space Science Education '2006