... Heterogeneous networks of multicomputers and the ch_nexus device . ... The startup files for the ch_nexus device are somewhat different, but easy to understand. ... If you have built MPI with ch_nexus device support on multiple platforms, you may not necessarily have the same startup_dir and startup_exe attribute values. ... The startup_count attribute indicates the number of nodes to be used on the SP-2 (in addition to any nodes you may be using on other workstations or multicomputers). ... Центры ...

Еще в разделе: (Показать все результаты (>320) - www.parallel.ru/ )

... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . Final program Accommodation Program committee Organizing committee . ... Moscow, April 10-14, 2007 Abstracts . ... An abstract should be prepared in MS Word according to the attached template. ... Abstracts should be sent by e-mail to io@cs.msu.su in an attached file. ... Accepted abstracts will be published in proceedings of the conference. ...

Еще в разделе: (Показать все результаты (>13) - io.cs.msu.ru/ )

• Important dates - ORM 2007

... Symposium expenses . ... Abstract submission . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... The deadline for abstract submission is 20 April, 2011. The abstracts have to be sent to the Symposium web address:? ed.mos2010@gmail.com .? ... Arial font and single spacing should be used throughout. The title should be centered and set with 14-point bold font style. ... The main body of text should be fully justified and set in 12-point regular font style. ...

Еще в разделе: (Показать все результаты (>14) - ged.chem.msu.ru/ )

• Important deadlines. 14 European Symposium on Gas Phase Electron Diffraction

... Zygote [ Zygote] . Common information . ... 0.782 . ... since 1998-05-02 till today . ... http://journals.cambridge.org/action/.. ... 1998-05-02 . today . ...

Еще в разделе: (Показать все результаты (>1036) - journals.genebee.msu.ru/ )

... TWikiRegistration . To edit pages on this TWikiSite , you must have a registered user name and password. Note: Registered users can change and reset their passwords. ... When TWiki receives the form, it will mail an account activation code to the e-mail address you gave above. ... Create your personal TWiki topic using your WikiName as topic name, and add the data you submitted to the topic. ... Note: Please contribute updates to this topic on TWiki.org at TWiki:TWiki.TWikiRegistration . ...

Еще в разделе: (Показать все результаты (>19469) - dualopt1.cmm.msu.ru/ )

• TWikiRegistration - TWiki - TWiki - (printable)
• %TOPICTITLE% ( vs. 1) - TWiki
• CGISessionDriverDBIDotPm - TWiki - TWiki

NATO Publishing Unit P.O. Box 17 3300 AA Dordrecht A U T H O R 'S D A T A B A S E E N T R Y S H E E T (to be submitted together with the scientific paper ) REFERENCE: ARW978587 TITLE OF THE NATO MEETING/ NATO ASI SERIES VOLUME : Use of Humic Substances to Remediate Polluted Environments: from Theory to Practice NAME OF THE DIRECTOR: Dr. Norbert ... The total space available for keywords and abstract of your paper is 900 characters (approx. 100 words). ...

Еще в разделе: (Показать все результаты (>94) - mgumus.chem.msu.ru/ )

• MGUMUS -- Second International Conference of CIS IHSS on Humic Innovative
• MGUMUS -- Third Conference of CIS IHSS on Humic Innovative Technologies Humic
• MGUMUS -- First International Conference on Humics-based Innovative

Experience with OO Database for CMS Events Distributed Between Two Sites. ... Participation of Russian institute (5% of all CMS simulations): Spring 2000 year - SINP MSU + ITEP - 50000 events , 25 GB transferred to CERN Autumn 2000 year - SINP MSU + ITEP + JINR - 110000 events , 180 GB transferred to CERN Autumn 2001 year - ( SINP +RRC)+ ITEP + JINR +FIAN - 270000 events , OO Database distributed between SINP and ITEP ~200 GB ...

Еще в разделе: (Показать все результаты (>47) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/pose/talk.doc
• http://acat02.sinp.msu.ru/presentations/shawhan/shawhan_plenary.pdf
• http://acat02.sinp.msu.ru/poster-sessions.html

The development of the method for the analysis of proteomics data Dmitry S. Ischenko, V. Popkov Moscow Institute of Physics and Technology, Dolgoprudny, Russia, ischenko.dmitry@gmail.com Dmitry G. Alexeev Scientific-Research Institute of Physicochemical medicine, Moscow, Russia, exappeal@gmail.com In the analysis of mass spectrometry data of unannotated sample the problem is in an adequate evaluation of the results. The question is: what to choose as a protein database for searching? ...

Еще в разделе: (Показать все результаты (>158) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/222.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/39.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/202.pdf

. HOME . ABOUT . RESEARCH . NEWS . PUBLICATIONS . DATA . COLLABORATION . OUTREACH . CONTACT US . outreach . ПРЕЗЕНТАЦИИ Panasyuk M. (SINP, Russia). Relec . ШКОЛЬНИКАМ Using a database of university satellite "Vernov" in school project work. Использование данных университетского спутника "Вернов" в школьных проектах. Experiment and database description | Описание эксперимента и базы данных(doc file ~6 Mb) . Database files (FTP archive) | Файлы данных (FTP-архив) .

Еще в разделе: (Показать все результаты (>2) - vernov-relec.sinp.msu.ru/ )

LangueDOC . Home . Archives . Languages . ... Movie . Course materials . ... Publications . RUSSIAN . ... In the Spring semester of 2007, the Department of Theoretical and Applied Linguistics of the Philological faculty at Moscow State University started offering elective courses that introduce students to technical topics that are useful, indeed necessary, for documenting endangered languages. ...

Еще в разделе: (Показать все результаты (>331) - www.philol.msu.ru/ )

• MSCL-3 | Call for Papers

. Scobeltsyn Institute of Nuclear Physics , . Moscow State University , . Experimental High Energy Physics Department . RU-119899, Moscow, Russia . Phone (work) :(+7)(095)939-5881 . Fax :(+7)(095)939-3064 . E-mail : dudko@lev.art.ru . (.ps.gz) . (.ps.gz) , pdf . (.ps.gz) , pdf .

Еще в разделе: (Показать все результаты (>4) - top.sinp.msu.ru/ )

... A REVISION OF THE ALMAGEST . ... T HE C ARNEGIE I NSTITUTION OF W ASHINGTON , 1915 . ... Errors of Ptolemy's longitudes . ... List of manuscripts collated . ... Notes on the manuscripts . ... Errors in manuscripts . ... The Catalogue . ... Catalogue I . ... Catalogue III . ... Notes to the Catalogue of Stars . ... The star magnitudes . ... Notes on the star magnitudes . ... Collations of manuscripts -- Longitudes . ... Collations of manuscripts -- Latitudes . ...

Еще в разделе: (Показать все результаты (>134) - hbar.phys.msu.ru/ )

• articles on ancient observations
• R.R.Newton, "Astronomical evidence..."

: ?SAP HANA ґ the main memory database platform for modern hardware? ?SAP HANA ґ ? 23 2013 . 18.30 : Franz Faerber, : - SAP SAP HANA (High-Performance Analytics Appliance) ґ , . ?in-memory? SAP . , SAP HANA ?in-memory? , , . SAP HANA , SAP HANA, SAP Labs . : Franz Faerber, SAP 1994 ., - SAP. SAP HANA, . : . .. , (2- ), . -8 ! 22 : mag-prog@lvk.cs.msu.su http://erp.cmc.msu.ru/ 247, : +7 (495) 939-55-68

Еще в разделе: (Показать все результаты (>2) - master.cmc.msu.ru/ )

... The bright supernova (hereafter SN) in the galaxy NGC 4527 was first sighted by S. Knight (USA) on April 13.17UT at magnitude ~14.0v. The report of the sighting was subsequently forwarded by phone to the AAVSO. ... SN 1991T. The galaxy NGC 4527 is an Sb(s)II type galaxy with an apparent Blue magnitude of 11.32 (Shapley-Ames, 1981). ... An analysis of this event utilizing visual observations by amateurs, plus a light curve is presented.. ... THE LIGHT CURVE: . ... ISN SN 1991T web page . ...

Еще в разделе: (Показать все результаты (>31) - www.rochesterastronomy.org/ )

... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . История ГАИШ и Московской обсерватории . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... Welcome to the Extra-galactic research group of SAI ! ... Sternberg Astronomical Institute is older than the entire field of extra-galactic astronomy. ... At the same time, the Extra-galactic astronomy group as an element of the institute structure remains the youngest subdivision of SAI. ... 2007, astro-ph/0709.3047 . ...

Еще в разделе: (Показать все результаты (>36) - www.sai.msu.ru/ )

• Uploading Files
• The Catalogue of Interacting Galaxies by Vorontsov-Velyaminov
• Moscow Astronomical Plate Archives: Contents, Digitization, Current and

... Preliminary evaluation of forest ecosystems' state near the smelter was made, the monitoring methodology for polluted areas was developed, and critical loads of acid deposition were assessed (see also soil.msu.ru/projects/acidification/ ). ... The new built up database on forest ecosystem data for permanent monitoring plots was used for analysis of soil chemical state in forest ecosystems subjected to airborne pollution in the fragile boreal environment in the Norwegian-Russian border area. ...

Еще в разделе: (Показать все результаты (>7) - eco.soil.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... 15.12.2015 . ... Oral abstracts submission deadline - May 01, 2015 . Poster abstracts submission deadline - June 01, 2015 . ... Words and Light . International Year of Light 2015 Literary competition Words and Light . The deadline for entries is 31 March 2015. 2009 ILC MSU Made in: Sebekon IT Solutions . 2009 Chair of GP and WP, physical department Made in: Sebekon IT Solutions . ...

Еще в разделе: (Показать все результаты (>247) - ofvp.phys.msu.ru/ )

• Diploma thesis abstracts of year graduate students

About Journal . ... Issues of the year 2015 . ... E-mail: am100@inbox.ru . ... Center for Ice and Climate, University of Copenhagen, Juliane Maries Vej 30, Copenhagen 2100?ь, Denmark . ... INDEXING OF MAPPING SCIENCE JOURNALS Abstract: . ... Only a few mapping science journals appear in the Directory of Open Access Journals , despite the large number of open access mapping science journals available. ... SEASONAL MORTALITY PATTERNS DUE TO DISEASES OF THE CIRCULATORY SYSTEM IN PORTUGAL Abstract: . ...

Еще в разделе: (Показать все результаты (>241) - www.geogr.msu.ru/ )

• "Пластовые льды"
• Instructions for Authors, contributing to ?GEOGRAPHY, ENVIRONMENT,
• КУРСЫ ПО ЦИФРОВОМУ ПОЧВЕННОМУ КАРТОГРАФИРОВАНИЮ

Academic English Part 4 of 4 Sources: 1. ... Cambridge University Press Unit After Ї Ї 51 completing the tasks the students will: Learn about US system for higher education in science Learn some communicative strategies they might use when asking for help or information from colleagues Ї Learn to write a CV and participate in an interview Ї Revise their reading strategies Ї Revise their summarizing strategies Camb 1. 2. 3. 4. ridge English for Scientists, Unit 1, pp.6-7 all ...

Еще в разделе: (Показать все результаты (>16) - www.eng.math.msu.su/ )