... Поиск по МГУ | Лента новостей | ... О проекте . ... Please, enter the code that you see below in the input field. This is for blocking bots that try to post this form automatically. If the code is hard to read, then just try to guess it right. If you enter the wrong code, a new image is created and you get another chance to enter it right. ... 2003 2011 MsuNews.Ru Новости МГУ . 2003 2011 Разработка и дизайн MMForce.Net . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>28) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ
• MsuNews.Ru | Блог проекта
• MsuNews.Ru | Энциклопедия

Клуб выпускников МГУ (Московский Государственный Университет) . By national TV "NEW CHANNEL", UKRAINE. New quantum technology in the field of biocybernetics . ... NEW CYBERNETIC BODY WITH THE BEST QUALITY OF REAL LIFE. ... B контексте моей теории плазма, это не ионизированный газ, а форма материи, из которой состоит внутренняя структура частиц. ... NEW QUANTUM THEORY OF ATOM'S NUCLEUS PRESENTED BY THE AUTHOR, DR. KOSTIANTYN RASIN. ... NEW ERA OF QUANTUM TECHNOLOGIES JUST BEGUN.. ...

Еще в разделе: (Показать все результаты (>229) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: GlowByte
• Клуб выпускников МГУ: Хотите жить дольше? 3 основных секрета

.

Еще в разделе: (Показать все результаты (>35) - lav01.sinp.msu.ru/ )

List of available DNA-protein and RNA-protein complexes . List of Pfam domains presented in DNA-protein and RNA-protein complexes . List of SCOP domains presented in DNA-protein and RNA-protein complexes . ... Amino acid code changer : 3-letter code to 1-letter code and vice versa . The work is supported by the Russian Foundation of Basic Research, grants 06-07-89143 and 06-04-49558, and INTAS, grant 05-1000008-8028 ...

Еще в разделе: (Показать все результаты (>131) - monkey.belozersky.msu.ru/ )

• About this project
• Search for potential water bridges between protein and nucleic acid
• DNA/RNA-Protein structures

... Описание вакансии: . The Famous FMCG Company (Top-3) looks for Standards Office Manager in R Department . ... Create and register R and Regulatory documentation . ... Manage update of documentation in valid forms. Daily tracking of documentation validity and make changes in proper time to ensure the correct and on time activity of commercial production. ... Fluent English and excellent computer skills, skills to work with the databases . High skills to work with people; teamwork skills . ...

Еще в разделе: (Показать все результаты (>22) - www.chemport.ru/ )

• "R@d manager" - вакансия в разделе "Работа для химиков" @ChemPort.Ru
• "Head of chemistry" - вакансия в разделе "Работа для химиков" @ChemPort.Ru

Title Author Key words Review of the monograph Yu.G. Volkova "Creativity: creativity against imitation" Dmitriev A.V. creative class, creativity, creative, imitation This article is reviewed monograph Yu.G. Volkova "Creativity: creativity against imitation" (2013). ...

Еще в разделе: (Показать все результаты (>26) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2011/2/05.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/2/11.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/4/17.pdf

Главная Программы Магистратура Программа "Международный бизнес и стратегия" Курсы по выбору МА13 Весна 2013 . International Marketing (Abdolreza Eshghi) . ... Global marketing\'s main job is to create customer value in the global marketplace. This intensive seminar focuses on how managers evaluate global market opportunities and develop market entry and expansion strategies in order to create customer value on a global basis. ... Business Ethics (Gerald Rohan) . ...

Еще в разделе: (Показать все результаты (>86) - www.mgubs.ru/ )

• The Ljubljana Summer school
• Преподаватель ВШБ МГУ Вячеслав Болтрукевич выступил на конференции EFMD
• Конкурс на лучшее эссе года

. Moscow State University . Physics Department . Russian Academy of Sciences . Institute of Organoelement Compounds . Language: . RUS / ENG . Source: russia.ru, 09.2008 . Source: russia.ru, 09.2008 . The news are available in Russian only . Seminar of the Polymer Council of RAS . Seminar in Polymer Physics . Seminar in Electrochemistry

Еще в разделе: (Показать все результаты (>116) - polly.phys.msu.ru/ )

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>8) - polit.msu.ru/ )

• Новости факультета

... ECOLOGICAL COOPERATION" . ... Brjanskaja oblast, Dubrovskij rajon, Seshcha (village), School . Brjanskaja oblast, Djat'kovskij rajon, Bytosh (village), School . ... Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Borodino (village), School . Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Yardenikha (village), School . ... Moscow, Children's Ecological Center of the National Park "Losinyj Ostrov" - the coordinator of ecological work of 18 Korolev-town's schools . Moscow, School #222 . ...

Еще в разделе: (Показать все результаты (>10) - www.ecocoop.ru/ )

• For three and half years of activity the participants of Ecological Cooperation

... J. 15(2): 263-268 ї RUSSIAN ENTOMOLOGICAL JOURNAL, 2006 3I, a new program for creating Internet-accessible interactive keys and taxonomic databases and its application for taxonomy of Cicadina (Homoptera) 3I - новая программа для создания интерактивных определительных таблиц и таксономических баз данных для Интернета и ее применение в систематике цикадовых (Homoptera: Cicadina) Dmitry A. Dmitriev Д.А. Дмитриев Illinois Natural History Survey, 1816 South Oak Street, Champaign IL 61820, USA. ...

Еще в разделе: (Показать все результаты (>864) - zmmu.msu.ru/ )

• Invertebrates
• Exhibition
• Exhibition of Insects

... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...

Еще в разделе: (Показать все результаты (>6) - depository.msu.ru/ )

• Biological information | depozitariy
• Main grant | depozitariy

Конференция . ... 3-е сообщение . ... 1-е сообшение . ... Вселенная . ... Научная конференция . ... Всероссийская Астрономическая Конференция (ВАК-2004) . Горизонты Вселенной" . Всероссийская Астрономическая Конференция (ВАК-2004) "Горизонты Вселенной", посвященная 250-летию Московского Государственного Университета им. М.В. Ломоносова, пройдет с 3 по 10 июня 2004 г. в Москве, на базе МГУ на Воробьевых Горах. ... Рабочий язык конференции русский. ... 03.06.04 . ...

Еще в разделе: (Показать все результаты (>2) - www.agora.guru.ru/ )

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>4) - www.rlcentre.com/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ HYDROACOUSTIC ANTENNA : A POWERFUL TOOL TO FORECAST TSUNAMIGENIC EARTHQUAKES Yakov S. Karlik Central Research Institute MORPHYSPRIBOR , 46 Chkalovsky proezd, Sankt-Petersburg, 197378 Russia E-mail: karlik@mail.cl.spb.ru ABSTRACT Hydroacoustic antenna ... 2001). ... Eiby, J.A., 1982: Earthquakes. ...

Еще в разделе: (Показать все результаты (>20) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E12_Marchuk.pdf

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>13) - heritage.sai.msu.ru/ )

• А.В.Засов. Задача 14: Определение цвета и морфологического типа удаленной
• А.В.Засов. Задача 12: ПЗС-Фотометрия Галактики

... Publications . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Lomonosov Moscow State University . ... Publication type . Conference paper . ... Publication date . ... Conference . 17-th International Conference on Computer Graphics GraphiCon'2007 . ... Moscow, Russia . ... BookTitle = {17-th International Conference on Computer Graphics GraphiCon'2007}, . ... Address = {Moscow, Russia}, . ...

Еще в разделе: (Показать все результаты (>108) - imaging.cmc.msu.ru/ )

• Basic edges | Laboratory of Mathematical Methods of Image Processing

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Departments . ... Field training . ... The department curriculum is focused on preparation of experts of the top skills in the field of tourist business, tourist service, the government in tourism sphere. ... A theme of scientific work of department Territorial touristic-recreational systems: natural and social and economic preconditions of a sustainable development includes three underthemes. ...

Еще в разделе: (Показать все результаты (>37) - eng.geogr.msu.ru/ )

... IMPACT: New carbon-based materials with exceptional chemical and physical properties . ... AREA: Condensed Matter Physics, Physical Chemistry, Structure and Dynamics of Atomic-Molecular Systems, Engineering Sciences and Mechanical Engineering . ... Moscow State Uiversity . ... STRATEGY: Application of ab initio methods for simulation of forbidden reflections energy spectra taking into account thermal displacements of atoms and protons fluctuations. ... AREA: Condensed Matter Physics . ...

Еще в разделе: (Показать все результаты (>41) - hpc.msu.ru/ )

• Supercomputing Education Project | Moscow University Supercomputing Center
• SIGMA: Collective Bank of Tests on Parallel Computing | Moscow University
• Nationwide Supercomputing Education Project | Moscow University Supercomputing