... Three-dimensional simulation of the dynamics of deformable droplets of an emulsion using the boundary element method and the fast multipole method on heterogeneous computing systems" . ... An efficient approach to simulate the dynamics of a large number of deformable droplets is proposed. ... Keywords: deformable droplets, Stokes equations, boundary element method, fast multipole method, parallel computing, graphics processors . ...

Еще в разделе: (Показать все результаты (>3) - num-meth.srcc.msu.ru/ )

• "Acceleration of molecular dynamics simulations using the fast multipole method
• "Simulation of bubble dynamics in three-dimensional potential flows on

... Dumb holes - what are they, how do they work Analogue gravity , Hawking radiation and black hole lasers in Bose-Einstein condensates Analogue gravity models in dielectrics (4 (4 (3 (3 (3 (3 hours hours hours hours hours hours ) ) ) ) ) ) Matt Visser, Victoria University of Wellington, New Zealand Theodore Jacobson, University of Maryland, USA Ralf SchЭtzhold, UniversitДt Duisburg-Essen, Germany William Unruh, ...

Еще в разделе: (Показать все результаты (>17) - phys.msu.ru/ )

• Лекторий
• Сотрудники физического факультета МГУ

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Белый В.Ф. Вулканические формации и стратиграфия северной части Охотско-Чукотского пояса. ... Магадан: СВКНИИ ДВО РАН, 1998. 108 с. Бондаренко Г.Е., Морозов О.Л., Лэйер П., Минюк П.С. Новые данные Ar-Ar изотопного датирования магматических и метаморфических пород полуострова Тайгонос (Северо-Восток России) // Докл. ... Бондаренко Г.Е. Новые данные SHRIMP U-Pb исследований цирконов из гранитоидов Прибрежно- и Восточно-Тайгоносского поясов, южная часть п-ова Тайгонос // Доклады РАН. ...

Еще в разделе: (Показать все результаты (>6) - phys.web.ru/ )

• Учебник по экспериментальной и технической петрологии - Все о Геологии

... 2010. н 384 .; . ... Prentice Hall, 1992; Hill A. How investors react to political risk//Duke Journal of comparative and international law. ... New York: McGraw-Hill, 2000; Charles R. Kennedy (1988), "Political Risk Management: A Portfolio Planning Model," Business Horizons, 31(6); Carlson, Sunne. ... Published by Ashgate Publishing Ltd., 2012. н 200p.; Robock, Stephan H. "Political Risk: Identification and Assessment". ... Political Risk & International Business: Case Studies in Southeast Asia. ...

Еще в разделе: (Показать все результаты (>7) - www.spa.msu.ru/ )

• http://www.spa.msu.ru/uploads/files/h8dissertazionnii_sovet_d_501.001.27h8brh923.00.02__polititcheskie_instituti_prozessi_i_tehnologiih9/avtoreferat_vasileva.pdf

... Registration and Abstract submission are open for the International Conference on Physics Education ICPE 2014 , that will take place at the Sheraton Cordoba Hotel & Convention Center, C rdoba, Argentina, on August 18th to 22th, 2014. ... Keynote Speaker: Cedric Linder , Professor of Physics Education Research, Division of Physics Education Research, Department of Physics and Astronomy, Uppsala University, Sweden. ... Prof. Zulma Gangoso (Chair) . ... Prof. Zulma Gangoso (Argentina) . ...

Еще в разделе: (Показать все результаты (>2) - foroff.phys.msu.ru/ )

... 3 3.1 -- , ( quantum bit of information, qubit). , . ... NOT CNOT . ... CNOT (Controlled NOT), : C N OT (R00 |00 +R01 |01 +R10 |10 +R11 |11 ) = R00 |00 +R01 |01 +R11 |10 +R10 |11 XOR. ... N OT (a |0 +b |1 ) = b |0 +a |1 F uncN OT (q1 , q2 , q3 , q4 ) = (q3 , q4 , q1 , q2 ) C N OT (R00 |00 +R01 |01 +R10 |10 +R11 |11 ) = R00 |00 +R01 |01 +R11 |10 +R10 |11 F uncN OT (R00 , R01 , R10 , R11 ) = (R00 , R01 , R11 , R10 ) 5 5.1 , , . ... n - , , : F =H l-1 R l-2,l-1 H l-2 Rl-3,l-1 Rl-3,l-2 Hl-3 Rl-4,l-1 R ....

Еще в разделе: (Показать все результаты (>8) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/kurs5-sych-ru.pdf

Book Review Struct Multidisc Optim 28, 372 ґ 373 (2004) DOI 10.1007/s00158-004-0451-7 A.P. Seyranian and A.A. Mailybaev: "Multiparameter Stability Theory with Mechanical Applications" World Scientific Publishing Co. ... A remarkable feature of the book is the authors' presentation of a new multiparameter bifurcation theory of eigenvalues, which is a key point for the stability and instability studies. ... The material of the book is organized into 12 chapters. ...

Еще в разделе: (Показать все результаты (>2) - mailybaev.imec.msu.ru/ )

IBVS 5422-t3.txt #IBVSdataKey: other 001. ... T. Kato, vsnet-newvar, 2000-2001 (http://vsnet.kusastro.kyoto-u.ac.jp/vsnet/Mail/vsnet-newvar/maillist.html). ... IAU Circ No. ... K. Haseda, IAU Circ No. 7808, 2002. 131. http://vsnet.kusastro.kyoto-u.ac.jp/vsnet/Novae/hadv105.html. ... V. Tabur, IAU Circ No. 8001, 2002. 135. http://vsnet.kusastro.kyoto-u.ac.jp/vsnet/Novae/nsgr02-4.html. ... K. Haseda, IAU Circ No. 7647, 2001. 137. http://vsnet.kusastro.kyoto-u.ac.jp/vsnet/Novae/nsco01.html. ...

Еще в разделе: (Показать все результаты (>7) - www.sai.msu.ru/ )

• IBVS 5422 - The 77th Name-List of Variable Stars - References

... Автореферат разослан ?22? ноября 2013 г. Ученый секретарь диссертационного совета Е.В. Маринина Общая характеристика работы Реферируемая диссертация посвящена изучению цитат из поэтических произведений британских авторов в современном английском языке и речи. ... Научная новизна работы заключается в рассмотрении корпуса поэтических цитат из британских авторов с точки зрения филологической топологии, т.е. учения об инвариантности и варьировании в филологии, и с применением ее методов. ...

Еще в разделе: (Показать все результаты (>29) - ffl.msu.ru/ )

• http://www.ffl.msu.ru/research/avtoreferats/98-solodovnikova_avtoreferat_09.doc
• http://www.ffl.msu.ru/research/avtoreferats/97-solovieva-avtoreferat.doc

... 60° , /2 , / , / , / , / 2 2 2 482 152 0,03 16 1,4 634 0,07 , / 0,05 157 174 0,64 37 3,4 331 0,52 0,10 97 182 0,75 44 4,1 279 0,59 0,15 70 186 0,79 47 4,4 256 0,63 3 0,20 54 188 0,82 49 4,5 242 0,65 0,25 44 190 0,83 50 4,6 234 0,66 5 0,1 /3. ... 1961. ... Rockel B., Raschke E., Weyres B. A parameterization of broad band radiative transfer properties of water, ice and mixed clouds // Beitr. ... Slingo A. A GCM parameterization for the shortwave radiative properties of water clouds // J. Atmos. Sci. ...

112. http://mccmb.belozersky.msu.ru/2013/MCCMB13_Program_2307e.pdf

113. http://www.law.msu.ru/doc/maleshin-rus-civil-proc.pdf

114. THE MAKKAVEEV LABORATORY OF SOIL EROSION AND FLUVIAL PROCESSES