E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>23) - srcc.msu.ru/ )

• D.D.Sokoloff, A.F.Lanza, D.L. Moss, S.M.Tarbeeva. Polar branches of stellar
• Moss, D., Sokoloff, D., Lanza, A. F..Polar branches of stellar activity waves:
• Laboratory of Informatics

MSU . ... Every year since 2004, the MSU Science Park has conducted an educational program and an innovation project competition called Success Formula (www.successformula.ru). ... In collaboration with the Center of Technology Transfer at Moscow State University and the Chair of Innovation Economics, MSU Science park offers a wide range of educational programs like Success Formula as well as infrastructure projects geared to the incubation of new technology companies on the Moscow University site. ...

Еще в разделе: (Показать все результаты (>3) - www.sciencepark.ru/ )

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>42) - chaos.phys.msu.ru/ )

• Dzhanoev's home page
• Nonlinear Dynamics''s Page
• Science

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr. ... Lorem ipsum dolor sit amet. Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. <div class="myclass">...</div> . ... Lorem ipsum dolor sit amet, consetetur sadipscing elitr, sed diam nonumy eirmod tempor invidunt ut labore et dolore magna. ...

Еще в разделе: (Показать все результаты (>4) - physcontrol.phys.msu.ru/ )

• List All Categories

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>80) - hbar.phys.msu.ru/ )

• Какой сейчас век? Лекция 7
• Какой сейчас век? Лекция 5
• Age Determinations by Radiocarbon Content: Checks with Samples of Known Age

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>3) - www.edst.msu.ru/ )

... Structure of Data . ... Catalog . ... The SAI OCL Catalog site provides several VO-enabled modes of operation: . VO-enabled catalog data analysis from a browser . ... Endpoint URL is http://ocl.sai.msu.ru/catalog/conesearch/ . ... VO-enabled catalog analysis from a browser . Presently, this recipe works with Firefox (Windows, MacOS, Linux), Internet Explorer (Windows) and Opera (Windows) browsers with Java plugin 1.6 installed. ... Main TOPCAT window with SAI OCL catalog loaded will appear. ...

Еще в разделе: (Показать все результаты (>3) - ocl.sai.msu.ru/ )

... Submit your article . ... Natalia S. Grigorieva Ph.D., professor, School of Public Administration, Lomonosov Moscow State University. E-mail: grigorieva@spa.msu.ru . ... Irina V. Yakovleva Ph.D., senior lecturer, School of Public Administration, Lomonosov Moscow State University. ... This article analyses the phenomenon of childlessness grounded on the sociological research carried out in different countries. ... There are two different approaches to the phenomenon of voluntary childlessness. ...

Еще в разделе: (Показать все результаты (>48) - ee-journal.spa.msu.ru/ )

All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>35) - classic.chem.msu.su/ )

• Firefly/PC GAMESS DOCUMENTATION - XMCQDPT2
• PC GAMESS version 7.1 to version 7.1.5 update information

... Two cookies are used by this site: . The essential one is the session cookie, usually called MoodleSession. You must allow this cookie into your browser to provide continuity and maintain your login from page to page. When you log out or close the browser this cookie is destroyed (in your browser and on the server). ... It just remembers your username within the browser. This means when you return to this site the username field on the login page will be already filled out for you. ...

Еще в разделе: (Показать все результаты (>10565) - moodle.ffl.msu.ru/ )

• Moodle пєп?п?п? п?п?пе: Login to the site
• Summary of Intercultural Communication in the Global Classroom

The Nine Planets is best viewed on-line via a graphical WWW browser which displays the pictures in color and supports hypertext link traversal. ... To view the movies and hear the sounds, you'll need additional helper programs. ... I recommend that you use Netscape as your browser. Netscape can display gif and jpeg images directly without need of any additional helper apps. You do need additional helper apps for movies and sounds, however. ... Yahoo's Helper Applications .. ... Tech Help .. ...

113. Index of /courses/geo/lib/books/Brown x26; Mussett The Inaccessible Earth/

114. Index of /~basrav/supercomp2010

115. Index of /lk/source

116. Вектор Творчества

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда