Generale Information . ... Students . ... Scientific Work . ... Department of Lithology and Marine Geology unites two laboratories: Laboratory of Lithology and Facial Analysis and Laboratory of Marine Geology , there is a branch in Geological Institute of Russian Academy of Sciences . The training of the students is carried out on educational direction 011100 "Geology", the department lets out the bachelors and diplomaed experts in specializations 011104 "Lithology" and 011105 "Marine Geology". ...
Near-Infrared spectroscopic imaging of cardiovascular disease Kupriyanov V.V. Institute for Biodiagnostics, 435 Ellice Avenue, Winnipeg, R3B 1Y6, Canada, 1-204-9846620, Valery.Kupriyanov@nrc-cnrc.gc.ca Applications of near-infrared spectroscopic (NIRS) imaging to detection, localization and grading of acute cardiac ischemia and chronic infarction in pig models in vivo are described. ... NIRS imaging is well suited for intraoperative applications during coronary artery bypass surgery in humans. ...
Postmagmatic Geochemical Processes in Kimberlites . ... The following oxide ratios ( wt% ) in minerals were taken for calculating Q: in calcite СаО : СО 2 = 1.27; in diopside MgO : CaO = 0.86; in diopside SiO 2 : CaO = 2.69; in phlogopite MgO : K 2 O = 3.72; in phlogopite SiO 2 : K 2 O = 5.81; in olivine SiO 2 : MgO = 0.81; and in dolomite MgO : CO 2 = 0.45. ... MgO phl = K 2 O kmb 3.72; SiO 2 phl = K 2 O kmb 5.81; . ... SiO 2 phl =К 2 О kmb 5.81; MgO ol = MgO kmb – MgO phl ; SiO 2 ol = MgO ol 0.81; . ...
... Mathematical Theory of Feedback Control . ... Annotation: this course is about mathematical equations of atmospheric diffusion which allow modeling of the problems of environment. ... The course reflects the experience and the point of view of a research group in the field of mathematical modeling of Western, Soviet and later Russian economics. ... Such approach captures the behavior of rather complex systems. ... Scientific Seminar: Mathematical Modeling of Complex Systems . ...
... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...
KEYWORDS: language evolution, mathematical modelling, branching processes . ... 2 Basic assumptions. ... Dying out, giving birth, and preserving of sign's meanings. ... Modelling of language evolution should be based on some assumptions concerning its micro-level, i.e. level of its micro-units' development. ... That is why it has become the starting point in the building of the mathematical model for the development in time and synchronic correlation of the whole system of a sign's features. ...
... Geography of World Economy . ... This led to the need to study the spatial organization of the world economy, geopolitics, the geography of international economic relations, regional integration of states and other relevant topics. ... Elena N. Samburova, PhD (Geography): geographical Sinology; the geography of international economic relations; position of Russia in the world economy; . ... Introduction into the Geography of World Economy: International Division of Labor (in Russian) . ...
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
. Выше: curs Пред.: Литература Содержание . This document was generated using the LaTeX 2 HTML translator Version 2002-2-1 (1.70) . Copyright ї 1993, 1994, 1995, 1996, Nikos Drakos , Computer Based Learning Unit, University of Leeds. Copyright ї 1997, 1998, 1999, Ross Moore , Mathematics Department, Macquarie University, Sydney. The command line arguments were: . latex2html -white -local_icons curs . The translation was initiated by Sergey E. Koposov on 2005-02-12 . Sergey E. Koposov 2005-02-12
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... You represent the Union of Rectors uniting the principals of almost all higher educational institutions of the country, and this association has well-deserved recognition. ... From V. Putin's speech at the meeting with the Russian Union of Rectors, Moscow, August 24, 2011. ... At the X Congress of the Russian Union of Rectors the President of RUR V.A. Sadovnichy suggested the creation of interactive inter-university scientific and educational project "University Department" . ...
... Conferences . ... International Scientific Conference "Probability Theory and its Applications" on Occasion of the 85-th Birthday of Yu.V.Prokhorov is organized by the Steklov Mathematical Institute , Faculty of Computational Mathematics and Cybernetics of Moscow State University , and Institute for Informatics Problems of Russian Academy of Sciences from 12 to 14 of February, 2015. ... CMC MSU students at GSIS Summer School, Tohoku University, Japan . ... CMC MSU тИТ GSIS Tohoku IT Joint Seminar . ...
. Links . arXiv.org (Lanl gov) . Large amount of articles . http://arXiv.org . Scientific Electronic Library . http://www.elibrary.ru . Elsevier Science; Kluwer Academic Publishers; Springer Berlin Heidelberg . and others... Laboratory of Theoretical Nonlinear Dynamics in Institute of Radio-Engineering and Electronics of RAS, Saratov Branch IRE RAS . http://www.sgtnd.tserv.ru . Head of the group Doctor of Sciences, Professor Sergey P. Kuznetsov . Painter Andrey Isaev . http://www.IsaevArt.ru .
... About choir . ... Performance the Academic Choir of the Moscow State University in Crocus City Hall . ... Bishop Tikhon opened the choir of Moscow State University in Vienna . Choir of Moscow State University spoke at the Vienna branch of the United Nations . ... Oldest amateur choir in Russia . Moscow state university Academic choirљ . ... Any questionsљby phone:љ+7 (495) 939-1862, +7 (495) 939-3563 . ...
old_news ]] . CompHEP . Trace: old_news . 25/05/2004 CompHEP version 4.4.3 is released БЂ¦б» More . 16/11/2003 CompHEP version 4.4.0 is released БЂ¦б» More . 01/11/2003 CompHEP version 4.2.1 that support old format of events is released. ... Community contributions . Community model library . ... CompHEP team . License . ... Installation guide . MAC OS installation . CompHEP-3.3 Manual . CompHEP-3.3 Manual (pdf) . ... CompHEP on the Web . ... CompHEP at LHC . ...
... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...
... The haloid compounds with perovskite-like structure undergo as a rule ferroelastic phase transitions (PT's) related to the soft modes of lattice vibrations. ... The analysis of the relationship between the susceptibility to external pressure at PT's from initial phase and the structural peculiarities has been carried out for some families of perovskite-like ferroelastics, namely: perovskites, elpasolites, antifluorites, compounds with the ordered ReO 3 structure and layered perovskites. ...
Lomonosov Moscow State University, Faculty of Mechanics and Mathematics, English Department On Borsuk's problem by A. Lukina, group 305, English teacher: A.A.Savchenko 1. ... It studies combinatorial properties of finite or discrete bodies or bodies with some particular characteristics, for instance, of a certain diameter. ... A number of questions arise from this problem. ... It is useful to deal with not just a body of diameter one, but with its approximation, called universal cover system. ...
ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...