... 001.89:004 .. , .. , .. , .. , .. , .., .. e-mail: kryukov@theory.sinp.msu.ru RESTFUL-- 2012-4/882 RESTful-- , : , , , UNIDATA Common Data Model, , , , , , . ... NCEP/NCAR [1], , ). , . ... RESTful-- , : , , , UNIDATA Common Data Model [2], , , , , , . ... UNIDATA Common Data Model (CDM) [2]. ... UNIDATA CDM 3. ... XML . ... Unidata Common Data Model. : http://www.unidata.ucar.edu/software/netcdf-java/CDM/ [3]. ... Network Common Data Form (NetCDF). : http://www.unidata.ucar.edu/software/netcdf/ [5]...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

• http://sinp.msu.ru/en/system/files/web_science.pdf
• SINP MSU

... Change password . Please enter the checkword and your new password . Login . Checkword . New password Confirm password . Recover password . ... Please log in. ... Password . ... Forgot password? Password request . Send me checkword . ... E-mail . ... If you cannot remember your password, enter your login or e-mail you have used for registration. A message containing the check word you can use to change the password will be sent to your e-mail. ... One-time password . ...

Еще в разделе: (Показать все результаты (>6) - www.ffl.msu.ru/ )

• Get Password - Факультет иностранных языков
• Authorization - Факультет иностранных языков

... Research . ... Linguistic expeditions . ... Up to now the subjects to documentation were local dialects of Selkup, Ket, and Evenki. ... 1) creation and enlargement of multimedia computer archives of Selkup, Ket, and Evenki speech, which include sounding dictionaries and folklore texts and life-stories in audio, video, and graphic representation in local dialects of the surveyed villages; development of linguistic multimedia databases; . ... 8) research into the Selkup-Ket-Evenki language contacts; ....

Еще в разделе: (Показать все результаты (>19) - lcl.srcc.msu.ru/ )

First Session : a general experimental and theoretical framework (Chair: A. Masiero) . Dark Matter: the experimental quest in the laboratory (C. RUBBIA) . LHC impact on Dark Matter searches (D. CERDENO) . ... Second Session : review of running Dark Matter experiments at LNGS and their future perspectives (Chair: E. COCCIA) . ... Fourth Session : review on the status and perspectives of Dark Matter searches carried out around the world and review of new proposals at LNGS (Chair: R. CASHMORE) . ...

Еще в разделе: (Показать все результаты (>237) - nuclphys.sinp.msu.ru/ )

• Журналы включенные в NSR (Nuclear Science References)
• The European X- Ray Free-Electron Laser
• Ядерная физика в интернете

... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... TPPMKOP is an utility developed for the automatic topology generation working well with OPLS-AA force field. ... This database is continually upgrading by our research group. ... OPLS-AA patch for different types of molecules ERG Research Group: Лаборатория теоретической биофизики написал (Февраль 8th, 2016 4:27 дп) . ... All-atom automatic OPLS-AA topology generator . ...

Еще в разделе: (Показать все результаты (>59) - erg.biophys.msu.ru/ )

• Quantum chemistry information page ERG Research Group: Лаборатория
• Using RESP with GAMESS-US and Firefly (PC-GAMESS) ERG Research Group:

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>29) - ecoinformatica.srcc.msu.ru/ )

... Manuscripts are classified in size into the three categories: . ... The most stringent requirements are imposed on manuscripts of the first category. ... Manuscripts of the second category should contain a representation of main results without excessive details in conclusions and proofs. ... Manuscripts should be prepared in electronic form using LaTeX 2.09 (see the instructions for manuscript preparation in electronic form) . ... The manuscript should be signed by its author(s). ...

Еще в разделе: (Показать все результаты (>108) - vestnik.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Seriya 1. Matematika. Mekhanika Instructions

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

To make visas please contact Olga I. Yakovenko . ... Date of birth: . ... Date of issue: . Date of expiration (your passports must be valid 3 months after the end of the sojourn in Russia): . ... Date of arrival in Russia: . Date of leaving Russia: . Single or multiple visa: . ... Location of the consulate where you will obtain the visa*: *) You are not obliged to come in the central Russian Consulate in your country for obtaining your visa. ... Visas to Russia . ... Information . ...

Еще в разделе: (Показать все результаты (>33) - seac47-2.phys.msu.ru/ )

• Database search page

Science . ... For 1st and 2nd-year students . Introduction to quantum physics . ... 2nd-year course work topics . ... For the history of our department a formal reference point is 1978 , when as a result of the reorganization of the Department of Wave Processes in the Physics Department of Moscow State University have two new departments : General Physics and Wave Processes ( OFVP ) and our department (up to 2001 - quantum physics, in 2001 renamed the Department of Quantum Electronics). ...

Еще в разделе: (Показать все результаты (>4) - quantum.phys.msu.ru/ )

• User account | Department of Quantum Electronics

Space Weather . ... Main page . ... Data . ... Data base . Satellite trajectory viewer . ... Storage and processing of space experiments, in conjunction with the Internet access system, are the main components of the system of space monitoring. ... CORONAS-F . ... The space monitoring data base contains measurements of domestic satellites since 1983. ... Now the data base continues to be filled up in line with the operational satellites connection timetable(Meteor-M ?1, Electro-L ?1). ...

Еще в разделе: (Показать все результаты (>2233) - swx.sinp.msu.ru/ )

• SWX - Данные Satellite trajectories
• Index of /models/database/db/001126
• Index of /models/database/db/000912

... Alexander A. Moskovsky . ... Software Designer : . ... Projects: . Janitor II, Custodian III for Matrix Logic - utilities for DOCS Open EDMS (electronic document management system), C++/Win32 platform. ~2 man-year project with 5 persons team. iBuzz - (for ibuzz.com ) large client-server system (Win32, Enterprize Java Beans, Oracle, Sun/Solaris). ... Lunch Ordering Web System. ... Software Resources International , former Digital Moscow Software Center, . ... Physical Chemistry chair, . ...

Еще в разделе: (Показать все результаты (>9) - lcc.chem.msu.ru/ )

• Laboratory of Chemical Cybernetics

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Full-time programs . ... Partners . ... All partners . ... Attraction of international students, development of cooperation with foreign partner universities is one of the priorities for the Faculty of Journalism. ... Foreign citizens can enter the Faculty of Journalism on a contract basis according to specific rules. ... Faculty of Journalism provides foreign applicants with a standard visa invitation. ...

Еще в разделе: (Показать все результаты (>66) - www.journ.msu.ru/ )

• International Media Management Academic Association's (IMMAA) Annual Conference

ISSUE 1 RUSSIA U.S. BILATERAL ON CYBERSECURITY CRITICAL TERMINOLOGY FOUNDATIONS APRIL 2011 The Russia U.S. Bilateral on Cybersecurity ­ Critical Terminology Foundations Issue 1 The principle editors of this document are: Karl Frederick Rauscher, EastWest Institute and Valery Yaschenko, Information Security Institute of Moscow State University. ... INFORMATION AND CYBER .. ... Scientific Adviser to the Director of the Lomonosov Moscow State University Institute of Information Security Issues. ...

Еще в разделе: (Показать все результаты (>26) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/bayern2009/global_dns.pdf

... About CIE MSU . ... Vestnik CIE (in Russian) . ... About Moscow University . ... The CIE provides tuition in Russian in accordance with the course of study and study programmes depending on the chosen subjects, goals, and forms of study as stated in the student s contract. ... Also the students can use the library, audio collections, video- and computer classes of the Center. ... Students are expected to attend classes, complete academic assignments, observe the University rules and regulations. ...

Еще в разделе: (Показать все результаты (>30) - www.cie.ru/ )

• Russian Language Programmes :: Academic Programmes :: CIE
• Documents Confirming Academic Background :: Admissions :: CIE

European Research Council IDEAS Coordination and Support Action (CSA) Call identifier: ERC -2009-SUPPORT Guide for Applicants Version: 16 July 2008 The Guide is published by the ERC -DIS on http:// erc .europa.eu It can also be downloaded from the CORDIS page on http://cordis.europa.eu European Commission FP7 Specific Programme IDEAS ... Consequently, the ERC needs to be rigorous in evaluating the very best science and researchers and in selecting innovative and "high risk/high gain" projects. ...

Еще в разделе: (Показать все результаты (>32) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/EPSS_guide.pdf
• http://ideas.msu.ru/docs/Work_programme_2011.pdf
• http://ideas.msu.ru/docs/ERC_guide_preparation.pdf

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>3) - math.phys.msu.ru/ )

INTERNATIONAL CONFERENCE HYDRODYNAMIC INSTABILITY AND TURBULENCE February 26 - March 05, Moscow, Russia ORGANIZED by Moscow State University, Institute of Mechanics of MSU and Faculty of Mechanics and Mathematics. ... SPONSORED by Russian Foundation for Basic Research, Moscow State University, Institute of Mechanics of MSU. ... Prospective participants must send abstracts in Word to the Organizing Committee (gertsens@imec.msu.ru) not later than 15 January 2006. ... Phone, E-mail and Fax number. ...

Еще в разделе: (Показать все результаты (>37) - hit-conf.imec.msu.ru/ )

... Кафедра нелинейных динамических систем . ... В понедельник, 11 апреля 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Автор: Фурсов Андрей Серафимович 09.04.2016 . В понедельник, 28 марта 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Сотрудники кафедры НДСиПУ, участвующие в 2016 г. в экзаменационной комиссии - Боресков А.В., Краев А.В., Бобылева О.Н., Гончаров О.И., Капалин И.В. Автор: Фурсов Андрей Серафимович 22.02.2016 . ...

Еще в разделе: (Показать все результаты (>4) - ndsipu.cmc.msu.ru/ )

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>7) - edas2.bioinf.fbb.msu.ru/ )

• Alternative Splicing DataBase.
• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.