... x25BA; Login to the site . Skip to create new account . Login here using your username and password . ... Username . Password . ... Some courses may allow guest access . ... For full access to courses you'll need to take a minute to create a new account for yourself on this web site. ... You can now access the full course. From now on you will only need to enter your personal username and password (in the form on this page) to log in and access any course you have enrolled in. ...

Еще в разделе: (Показать все результаты (>2) - www.kids.genebee.msu.ru/ )

... Data . ... Meteor-M тДЦ1 . ... Meteor-M тДЦ2 . ... Solar energetic particles . ... Solar flare database (RU) . ... Developers: David Parunakian, Wera Barinova, Oleg Barinov, Ludmila Mukhametdinova . Database administration: Sergey Bobrovnikov, Wera Barinova . Space physics models: Alexey Petrov, Rikho Nymmik , Boris Yushkov, Shugai Julia, Kuznetsov, Suvorova . ... Developed in 2007. Copyright ?й 2007 - 2016 Skobeltsyn Institute of Nuclear Physics Moscow State University Feedback ...

Еще в разделе: (Показать все результаты (>31) - smdc.sinp.msu.ru/ )

• Space monitoring data center
• Scientific services - Space monitoring data center
• OMNIweb mirror - Space monitoring data center

... News . For 1st and 2nd-year students . Introduction to quantum physics . ... About us . ... Create new account (active tab) . ... Request new password . E-mail * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Create new account . ... 2003 2016 Department of Quantum Electronics . ...

Еще в разделе: (Показать все результаты (>6) - quantum.phys.msu.ru/ )

... Our primary objective is the design and implementation of applied software tools for data processing, output and circulation of computer literature. ... Software tools for signal processing in medicine and engineering CONAN-m and CONAN-t. Statistical stable analysis tool for regression and factor models SIGN. ... Figurnov V.A. "IBM PC for Users" (in Russian). ... Boldin M.V., Simonova G.I., Tyurin Yu.N. "Sign Statistical Analysis of Linear Models" (in Russian and in English ). ... InCo . ...

Еще в разделе: (Показать все результаты (>3) - statsoft.msu.ru/ )

Supernova 2001dr in NGC 4932 . This page is devoted to information on Supernova 2001dr in NGC 4932 Basic information on this SN, including the last reported brightness, on this Supernova can be found on the main page . Information on the original web pages for many of these images can be found on the updates and links web pages. ... Web pages dedicated to this SN. AUDE has a 2001dr page in French [ Translate ] . ... Image Credit . ... 2001/08/14.88 . ... VSNET Light curve (requires JAVA). ...

Еще в разделе: (Показать все результаты (>101) - www.rochesterastronomy.org/ )

• Supernova 2001V in NGC 3987
• Nove in M32, 1998
• Supernova 2007av in NGC 3279

. Name . Last Modified . Size . Type . Parent Directory / . - . Directory . 10.2 / . 2009-Dec-06 17:59:27 . - . Directory . lighttpd/1.4.37

Еще в разделе: (Показать все результаты (>35) - curl.sai.msu.ru/ )

• Index of /pub/mirror/opensuse/

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... We plan to create a multi-channel analyzer through a detector which comprises a semiconductor in addition to the selective line of resistive type sensors , the sampling system also allowing to carry out a catalytic conversion and concentration of target gases. ... 2008-2014 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>28) - www.lssm.inorg.chem.msu.ru/ )

• Лаборатория химии и физики полупроводниковых и сенсорных материалов |
• The Laboratory of chemistry and physics of sensor and

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>36) - ideas.msu.ru/ )

• http://ideas.msu.ru/news/19_10_2010/Press_release.pdf

I. (SCIENCE CITATION INDEX ґSCI) WEB OF SCIENCE Web of Science (WoS) , , , , , Web of Science. ... Search>. ... WEB OF SCIENCE (SCIENCE CITATION INDEX) , Web of Science <Cited Reference Search>, , <Search>. ... Russian Acad Sci, Boreskov Inst Catalysis, Siberian Branch; - RAS, Boreskov Inst Catalysis SB; - SB RAS, Boreskov Inst Catalysis; - Boreskov Inst Catalysis; - Inst Catalysis; - Novosibirsk Catalysis Inst; - Boreskov Inst Catalysis SB RAS; - Boreskov Catalysis Inst; - GK Boreskov Inst Catalysis. ...

Еще в разделе: (Показать все результаты (>37) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/courses/crchem/urusov2.pdf

... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...

Еще в разделе: (Показать все результаты (>6) - depository.msu.ru/ )

• Biological information | depozitariy
• Main grant | depozitariy

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>23) - mouse.genebee.msu.ru/ )

. Number . Task . Pri . Author . Created By Tool . Created On . Modified On . Completed . Modified By . Assigned To . Link To . Magic . Description

Еще в разделе: (Показать все результаты (>152) - genphys.phys.msu.su/ )

• To Do List History
• Index of /rus/edu/kvant/II_2/STAT2/_private/distribution.files
• Index of /rus/edu/kvant/II_2/STAT2/_private/distribution.files/_vti_cnf

... 379.08 KB . ... 362.46 KB . ... 372.72 KB . ... 380.65 KB . ... 373.13 KB . ... 366.63 KB . ... 374.91 KB . ...

Еще в разделе: (Показать все результаты (>292) - www.geogr.msu.ru/ )

• CONTENT 3а(8)а2015
• louis vuitton fake bags louis vuitton outlet online cheap sales
• CONTENT 1?(4)?2011

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. ... April 11, 2013 - Bashneft Group in conjunction with JSFC "Sistema" opened the programme for the development of key Bashneft Group management - School of CEOs, "Capsule of security". ... At the end of his Welcoming Speech President of Bashneft Group stressed that this programme ? ... The School of CEOs ? ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• School overview | MSU Higher school of management and innovation
• MSU Higher school of management and innovation |
• Application for participation | MSU Higher school of management and innovation

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>2) - saistud.sai.msu.ru/ )

e-mail: infoippk@sfedu.ru) , , , , creative class, creative value, consumer practices, creative activities, social selfesteem . The article is devoted to analyzing the influence of the creative class on the consolidation of Russian society. ... This fact determines the impact of creative class on the acceptance of values of social creation by Russian society, as the basic value that has influence on the formation of social development priorities. ...

Еще в разделе: (Показать все результаты (>33) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2013/2/06.pdf
• http://www.socio.msu.ru/vestnik/archive/2014/1/13.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/2/11.pdf

LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...

Еще в разделе: (Показать все результаты (>3) - www.phys.msu.ru/ )

ACCL: what is that and what it is for . Animal Cell Culture Laboratory (ACCL) of the Faculty of Bioengineering and Bioinformatics was created in 2001 as one of the first service groups located in Laboratory Building Б of Moscow State University . ... Other persons are also welcome on the terms of individual agreement (see Services and Scientific Program ). We also have our own program of scientific research (see Scientific Program ). ...

Еще в разделе: (Показать все результаты (>170) - www.genebee.msu.ru/ )

• Selected Scientific Journals - Search Engines
• DIMACS Series in Discrete Mathematics
• BLAST 2.0 Release Notes