... COMPUTATIONAL . ... Scientific description and computerization of archives . Researchers of the Rare Books and Manuscripts Department of the Scientific Library of Moscow State University, the Orthodox Svyato - Tikhonovsky University and the Laboratory for Computational Lexicography are working on the scientific description of I. A. Ilyin’s personal archives. ... The conception of scientific description and computerization of archives was developed within the framework of this project. ...

Еще в разделе: (Показать все результаты (>17) - lcl.srcc.msu.ru/ )

TES data processing aims to divide the total field into components and to cancel these, caused by geological noise. The interpretation is fulfilled firstly in 1D variant (in the frame of horizontally-layered model, with IPI-1D package), and then in 2D variant (with IE2DL package). ... This model can be corrected with the help of different transformations for better seeing position and form of the deep objects. ... Two different approaches to the interpretation of profile VES data are possible. ...

Еще в разделе: (Показать все результаты (>61) - geophys.geol.msu.ru/ )

• TES tecnology. MSU.
• Links of engineering geophysics and software
• TRF_2d. Page2

... Individual SELEX products, aptamers, are small molecules (40­100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...

Еще в разделе: (Показать все результаты (>5) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf
• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf

... Human pro-B-type natriuretic peptide is processed in the circulation in a rat model. ... BACKGROUND: The appearance of B-type natriuretic peptide (BNP) in the blood is ultimately caused by proteolytic processing of its precursor, proBNP. ... RESULTS: ProBNP was effectively processed in the circulation into BNP (1-32) and various truncated BNP forms as confirmed by gel filtration and MS analysis. ... CONCLUSIONS: In rats, processing of human proBNP to active BNP occurs in the circulation. ...

Еще в разделе: (Показать все результаты (>48) - biochem.bio.msu.ru/ )

• Processing of pro-brain natriuretic peptide is suppressed by O-glycosylation in
• Processing of pro-B-type natriuretic peptide: furin and corin as candidate
• Biochemistry Department of Moscow State University | Education

... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...

Еще в разделе: (Показать все результаты (>8) - www.issp.ac.ru/ )

... Data . ... All links ] [ Models ] [ Space weather ] [ Research Institutions ] [ Data sources ] [ News sites ] [ Satellites ] [ Local library ] [ Education ] [ Journals ] [ Events ] . ... NSSDC Space Physics Models . ... Solar Influences Data analysis Center (Royal Observatory of Belgium) . ... Space Weather News Data Base . ... Space Weather Resources (NSSDC) . ... AAS Solar Planetary Division (AAS SPD) . ... Russian Space Science Internet . ... National Space Science Data Center (NSSDC) . ...

Еще в разделе: (Показать все результаты (>23) - smdc.sinp.msu.ru/ )

• Space monitoring data center
• RELEC - relativistic electrons

... Host City . ... Aug 31, 10.00 Excursion to Dmitrov . Excursion to Dmitrov Visit the ancient Russian town of Dmitrov and shake hands with Yuri Dolgoruki, a medieval Russian prince, who incidentally happens to be also the founder of the city of Moscow. Dmitrov known as the Moscow's Nohern pearl is just 65 kilometers north of Moscow on the suburban road. ... Dmitrov finally entered the Moscow county in the 16th century, after a lengthy internal struggle among its princes. ...

Еще в разделе: (Показать все результаты (>21) - www.elch.chem.msu.ru/ )

... Юрий (admin) Новости R , Statistics One , используем R , статистика 2 Comments . Statistics One, Assignment One #Read data, plot histograms, get descriptive library(psych) #Read the data into a dataframe called working_memory working_memory . Как повысить ТИЦ и PR от 100 рублей Statistics One, Lecture 3, example script . ... Дайджест психологических исследований . ЖЖ-сообщество ?RU_SPSS? ... Статистика блога . ... R-советы: Экономим время и место на диске путем сжатия файла данных . ...

Еще в разделе: (Показать все результаты (>18) - tukachev.flogiston.ru/ )

• Statistics One, Lecture 3, example script
• Statistics 1, Assignment 2
• Tag: Statistics One

... Дисциплины . ... On-line консультант . ... Главная Дисциплины Основы IT - менеджмента . Лектор и автор курса Козлов Д.Д. В курсе рассматриваются вопросы выстраивания экономически эффективной ИТ-инфраструктуры предприятия на основе сервисно-ориентированной модели ITSM. В рамках курса изучается библиотека IT Infrastructure Library и рассматриваются процессы управления информационно-коммуникационной инфраструктурой, предоставления и поддержки услуг. ... Copyright ВМиК МГУ , 2008 . ...

Еще в разделе: (Показать все результаты (>8) - erp.cmc.msu.ru/ )

MPI. ... C: #include <mpi.h> 14 MPI MPI- C (case sensitive): error = MPI_Xxxxx(parameter,.. ... Send : , , ­ Receive: , , 27 MPI () MPI - , (blocking) (non-blocking) ­ Blocking: ­ Non-blocking: , 28 MPI (modes) (Mode) Synchronous send Buffered send Standard send Ready send Receive (Completion Condition) ( ), ( ) ( ), 29 MPI «-» () (MODE) Standard send Synchronous send Buffered send Ready send Receive MPI MPI _ Send MPI _ Ssend MPI _ Bsend MPI _ Rsend ...

Еще в разделе: (Показать все результаты (>9) - angel.cmc.msu.ru/ )

The Future of GPU Computing Wen-mei Hwu University of Illinois, Urbana-Champaign Agenda · · · · Setting the Context Current Victories Coming Battles Conclusion and Outlook NVIDIA HPC Day Moscow State University 2012 CPUs: Latency Oriented Design · Large caches ­ Convert long latency memory accesses to short latency cache accesses ALU Control ALU ALU · Sophisticated control ­ Branch prediction for reduced branch latency ... NVIDIA HPC Day Moscow State University 2012 ...

Еще в разделе: (Показать все результаты (>5) - ccoe.msu.ru/ )

• http://ccoe.msu.ru/sites/default/files/RU_Apps_Catalog_Sep13_LR.pdf
• http://ccoe.msu.ru/sites/default/files/presentations/MSU-Lecture-CUDA-Intro-2012.pdf
• About the CCOE at Lomonosov Moscow State University | CUDA Center of Excellence

Mathematical modeling of biophysical processes in living cells and tissues . duration 6 months . ... 7(095) 939-26-12, Fax: +7(095)939-31-13, Email: romanov@yumr.phys.msu.ru . ... Interaction of femtosecond laser pulses with plasmas of modified targets . ... Theoretical investigations of polarization self-action and wave-interaction effects in nonlinear optics. ... Alexander V. Priezzhev, Associate Professor, Candidate of Sciences (physics and mathematics), Tel. ...

Еще в разделе: (Показать все результаты (>36) - foroff.phys.msu.ru/ )

• Postdoctoral training of foreign scientists at Physical Department

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... On the Institute . ... Development of relational methods of studying time [Chief: V.V. Aristov, Dr. Sci. (physics and mathematics)] . ... Physics of relic radiation, fundamental interaction mediator, carrier of space and time [Chief: I.M. Dmitrievsky, PhD (technology), Ass. ... Algebraic structure of space-time, algebrodynamics of fields and particles [Chief: V.V. Kassandrov, PhD (physics and mathematics)] . ... Causal mechanics [Chief: S.M. Korotaev, Dr. Sci. (physics and mathematics)] . ...

Еще в разделе: (Показать все результаты (>19) - temporology.bio.msu.ru/ )

... 1988) MERCURY Dollfus & Auriere(1974) Veverka et al. ... Lunar Crater name Ptolemaeus Bullialdus Gassendi crater maturity Im Is/FeO 1.452 68 1.451 68 1.415 75 Mercurian wavelength dependence of Pmax and lunar data 1,6 1 1,4 3 1,2 1 5 0,8 0,6 0,4 0,2 0 2,2 2,4 2,6 2,8 3 3,2 log l, (nm) Fig. 3 log Pmax, (%) 2 4 6 Conclusions: Maturity of the soil on the Mercurian surface in scale of whole disk is similar to space weathering of the soil in large old craters on the lunar highland. ...

Еще в разделе: (Показать все результаты (>78) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Shev/Publications/ms38/ms082.pdf
• http://selena.sai.msu.ru/Rod/Publications/ms40/21_Dolitsky_etal.pdf
• http://selena.sai.msu.ru/San/Publications/ms34/MS047.pdf

Russian . ... Projects . ... FADR conducts activities in (the) two general fields: information support for agribusiness and farmers, and the development and implementation of the new educational programms. ... The main focus of the Foundation for Agrarian Development Research (FADR) is the information support to agricultural producers. ... In 2000, the Canadian Agency for International Development regarded the Russian Rural Information Network project the best agricultural project. ...

Еще в разделе: (Показать все результаты (>157) - www.fadr.msu.ru/ )

• NAP - subject matter topics
• Abstracts
• Untitled

... Описание вакансии: . We seek a motivated and team-oriented individual who will be a key contributor to the overall success of BIND's chemistry program. ... Experience: . Polymer . ... Experience in synthesis of functional and biodegradable/biocompatible polymers. ... Familiarity with analytical methods for determination of polymer purity including gas chromatography, atomic absorption spectroscopy (ICP-OES/MS) and liquid chromatography (HPLC). ... Experience in peptide synthesis. ...

Еще в разделе: (Показать все результаты (>47) - www.chemport.ru/ )

• "Sbr process specialist for lg chem, korea" - вакансия в разделе "Работа для
• атмосферно-вакуумные разгонки D 2892 - D 5236 Minidist Plus C Gecil Process
• Crisis processes in russia. anti-recessionary measures. консалтинг

... 8-915-053-98-34, e-mail: stitova3@gmail.com URL: http://mobithinking.com 2 , 199 . ... URL: http://www.smart-edu.com/index.php/statie-learning/e-learning-v-rossii-%E2%80%93-itogi-2010-i-zadachi-na-2011.html Attewell J. Mobile Technologies and Learning: a technology update and m-learning project summary. ... URL: http://www.aupress.ca/index.php/books/120155 Savill-Smith C., Attewell J., Stead G. Mobile Learning in Practice: Piloting a mobile learning teachers' toolkit in further education colleges. ...

Еще в разделе: (Показать все результаты (>127) - ffl.msu.ru/ )

• About Us
• Научная жизнь

... Cleo batch system is purposed to control parallel tasks on computer clusters. It controls one or more task queues. tasks sceduling (all MPI implemetations are supported, most other parallel environments are supported too) . ... controllable user limits (max used cpus, task work time, etc.) . ... Any task in main will be queued to daughter queues if there aren't enough free own cpus (not shared with daughters). When daughter queues will get enough cpus for this task, it will be runned in main . ...

Еще в разделе: (Показать все результаты (>2) - parcon.parallel.ru/ )

... Moscow State Uiversity . ... Different wave function models and perturbations theory approximations are discussed, including the second Born one. ... Keldysh Institute of Applied Mathematics of RAS . DRIVER: Numerical investigation of aerodynamic and aeroacoustic charateristics of bluff aircraft elements and complex turbulent flows, design of better noise prediction tools for development of quieter aircrafts . ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>69) - hpc.msu.ru/ )

• MSU SUPERCOMPUTERS: "LOMONOSOV" | Moscow University Supercomputing Center
• APPLICATIONS: Electronics and Acoustics | Moscow University Supercomputing
• APPLICATIONS: Radiophysics | Moscow University Supercomputing Center