... Ph.D., Lead Consultant, Analytical Department, Ulyanovsk Region Administration, Ulyanovsk, Russian Federation. ... In this article regional budget forming and execution ex-post and ex-ante is examined on the example of Ulyanovsk region. ... Main factors reducing certainty in budget planning on regional level are late distribution of transfers from federal budget; randomly appearing budget costs (initiated on federal level), that are not provided by budget income; emergency and unexpected incidents. ...

Еще в разделе: (Показать все результаты (>167) - ee-journal.spa.msu.ru/ )

... О Школе . ... Магистерская программа Высшей школы бизнеса МГУ получила международную аккредитацию ABEST21 . ... В 2015 году Высшая школа бизнеса МГУ подтвердила статус одной из ста лучших бизнес-школ мира и получила награду высшей категории как 'бизнес-школа, имеющая наивысшее международное влияние'. 21.10.2015 . ... Декан Высшей школы бизнеса МГУ О.С. Виханский получил награду от Международной ассоциации бизнес-образования ABEST21 за 10-летний вклад в работу ассоциации в качестве ее Вице-президента...

Еще в разделе: (Показать все результаты (>4427) - www.mgubs.ru/ )

• ПРОГРАММА MBA модульный формат | Высшая школа бизнеса МГУ им. Ломоносова
• МАГИСТРАТУРА ВЫСШЕЙ ШКОЛЫ БИЗНЕСА МГУ | Высшая школа бизнеса МГУ им. Ломоносова
• Образовательные программы ВШБ МГУ | Высшая школа бизнеса МГУ им. Ломоносова

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>20) - observ.pereplet.ru/ )

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>18) - lcc.chem.msu.ru/ )

• Research Interests
• People
• Laboratory of Chemical Cybernetics

Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...

Еще в разделе: (Показать все результаты (>399) - geo.web.ru/ )

• М. И. Анохин, Н. П. Варновский, В. М. Сидельников, В. В. Ященко "КРИПТОГРАФИЯ В
• Pletchov Pavel biography info
• "Введение в криптографию" под редакцией В.В.Ященко - Все о Геологии (geo.web...

COMPUTER DESIGN OF HETEROCYCLIC RING-OPENING REACTIONS. ... Since the cleavage of ring bond requires appearance of new bond either between th e (endo) atoms of initial cycle, or between initial cycle and external (exo) group, the first case is treated as endoopening, and the another as exo-opening: Endo-Ring Opening Exo-Ring Opening © 1995 American Institute of Physics 75 7 758 Heterocyclic Ring-Opening Reactions General Methodology and Algorithms 1. ... RULE FOR ENDO-TYPE RJNG OPENING. ...

Еще в разделе: (Показать все результаты (>140) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/041e.pdf
• THE ALTERNATION RULE: AN OLD HEURISTIC PRINCIPLE OR A NEW CONSERVATION LAW
• Intuitive Chemical Topology Concepts

... Выпускники . Выпускники ВМиК . ... Женский клуб . ... Издательство МГУ . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... Австралия обновила список Особо востребованных специальностей (MODL). ... А вот, собственно, и сам обновленный список Особо востребованных профессий в Австралии: . ... Computing Professional - specialising in CISSP * . 2231-79 . ... Специалисты из списка MODL рассматриваются вне очереди, поэтому могут выехать в Австралию через 3-6 месяцев после подачи документов. ...

Еще в разделе: (Показать все результаты (>458) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Виза F-1 для студентов в США
• Клуб выпускников МГУ: 7 апреля компания WebScan Technologies представила
• Клуб выпускников МГУ: Конференция "Выпускники ВМиК"

Geology at Moscow State University . ... In 1804 the Chair of Mineralogy and Rural Home Economics was established at the Department of Physical and Mathematical Sciences. ... Geological education at Moscow State University is an important link in the whole system of higher education of the Russian Federation, and being the major educational and scientific centre of the country the Geology Faculty coordinates the work of other academic universities in the field of geological education. ...

Еще в разделе: (Показать все результаты (>69) - www.geol.msu.ru/ )

• Faculty of Geology >> Departments
• Faculty of geology Moscow State Lomonosov University
• Near-surface electrical prospecting laboratory at Moscow University

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• Comparison of protein phylogeny reconstruction methods

... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>14) - ani.cmc.msu.ru/ )

• Courses | Department of the Automation for Scientific Research CMC MSU
• The ASR Department at the CMC Faculty of Lomonosov MSU
• Alexander Valeryevich Pozdneev | Department of the Automation for Scientific

Status of mTCA Slow Control development at CMS Petr Volkov Lomonosov Moscow State University Skobeltsyn Institute of Nuclear Physics, Russia 6/27/2015 P. Volkov SINP MSU 1 uTCA: Introduction MicroTCA® - open standard for fabric computer systems. MicroTCA systems are both physically small and non-expensive. ... Use PVSSII and the JCOP Framework to develop your control applications. These are the official CMS DCS developing tools. ... CMS_MTCA_HCALTR_CRATE1 CRATES.. ...

Еще в разделе: (Показать все результаты (>195) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/proceedings2015/Collider_Volkov.pdf

Software Protection: How to Crack Programs, and Defend Against Cracking" In the first part of this course we will learn how to "crack" programs, i.e.how hackers break into software to extract secrets, remove license checks, etc. ... Learning about this type of computer security is important because many current systems are vulnerable to cracking attacks. ... The course will have practical homework exercises where you will crack small programs, and use tools to protect against cracking. ...

Еще в разделе: (Показать все результаты (>3) - master.cmc.msu.ru/ )

Форум МГУ Главная Форум > общие > . ... Ответов Просмотров . ... LalBiassE , 4 сен 2012 . Ответов: . ... Просмотров: . ... LalBiassE . 4 сен 2012 . Fewepoxy , 4 сен 2012 . ... Fewepoxy . ... Bimmemituefly , 4 сен 2012 . ... looraPlult , 4 сен 2012 . ... teensecub , 4 сен 2012 . ... Критерий сортировки тем: Дата последнего сообщения в теме Дата создания темы Название темы (по алфавиту) Число ответов Число просмотров Число благодарностей за первое сообщение . ... Главная . Форум . ...

Еще в разделе: (Показать все результаты (>2) - osk.msu.ru/ )

• Форум МГУ

Title Author Key words Evolution of social responsibility concept in the context of risk society Bronzino L.Y., Osipova E.D. social responsibility, risk society, social justice, state, power, network society The notion of social responsibility which is sufficiently detailed elaborate by modern social science is applied nowadays increasingly frequently as long as it is characterize various aspects and spheres of social life. ... Abstract ...

Еще в разделе: (Показать все результаты (>46) - www.socio.msu.ru/ )

• English version - Социологический факультет МГУ

... This button switches the current on. 2. to induce - to change continually or frequently. ... Wood is a poor conductor of heat. 4. to line up with - to cause to have a large amount of e.g. work to deal with.. ... His feelings fluctuated between excitement and fear. 6. putative -- smth that acts as a path for electricity, heat. ... Attitudes to the question are changing albeit slowly. 10. to chime with - to change slightly, esp. to make right or make suitable for a particular purpose or situation. ...

Еще в разделе: (Показать все результаты (>19) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Midterm_test.pdf

Marine mammals observations in the Gulf of Guayaquil on the south coast of Ecuador in Mayв?' June 2013 . ... Marine mammal (MM) observations were carried out during seismic survey of a 37 km2 area in water depths ranging from 37в?'58 m in the Gulf of Guayaquil in Mayв?' ... This short paper presents companion meteorological observations and considers the influence of weather and other environmental conditions on the frequency of the MM encounters. ...

Еще в разделе: (Показать все результаты (>916) - zmmu.msu.ru/ )

• Nathusius' pipistrelle

dan.guru.ru . Главная :: Об авторе . dan@parallel.ru . Об авторе: . ... Никитенко Дмитрий Александрович . ... ф-т вычислительной математики и кибернетики МГУ имени М.В. Ломоносова . 2002 . ... Научно-исследовательский вычислительный центр Московского государственного университета имени М.В.Ломоносова . ... 7(495)939-5216, +7(495)939-2347 . ... http://dan.guru.ru . Москва, 2002-.. ...

Еще в разделе: (Показать все результаты (>3) - dan.guru.ru/ )

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>13) - mph.cmc.msu.ru/ )

Supercomputer consortium of Russia's universities creation A G R E E M E N T Under this Agreement - Moscow State Lomonosov University, - Nizhny-Novgorod State Lobachevsky University, - Tomsk State University, - South-Urals State University, referred hereinafter as "the Parties", have defined their arrangements on creation of Supercomputer consortium of Russia's universities 1. ... The full official name of the entity in Russian language is: Supercomputer consortium of Russia's universities. ...

Еще в разделе: (Показать все результаты (>21) - www.rsr-online.ru/ )

• Structure

... MIT OpenCourseWare (бесплатные учебные курсы Massachusetts Institute of Technology ) . ... UCSB CS140 - Parallel Scientific Computing: Winter 2007 . ... Scientific Computing for Engineers (Prof. Jack Dongarra, Department of Computer Science (CS) at the University of Tennessee, Knoxville) . Introduction to Finite Element Methods (ASEN 5007) Fall 2007 (Department of Aerospace Engineering Sciences, University of Colorado at Boulder) . ...

Еще в разделе: (Показать все результаты (>7) - ani.cs.msu.su/ )

• The ASR Department at the CMC Faculty of Lomonosov MSU
• Courses