... Настройка OpenVPN для ОС семейства Windows описана на веб-сайте службы технической поддержки факультета ВМК . В данном разделе описывается подключение к VPN факультета в ОС GNU/Linux с помощью графического интерфейса, предоставляемого программой KNetworkManager на примере ОС openSUSE 11.2 x86-64. Кликните левой кнопкой мыши по иконке программы KNetworkManager в системном трее и выберете пункт Manage connections : . ... Также нужно выставить галочки ?Use LZO compression? и ?Use TCP connection?: ...
... Process of Forming a Company - Discussion Question . ... You receive appropriate support from the University. Also University of Alberta statistics show that very few (less than 5%) technologies are successfully commercialized independently, whereas 50% of the technologies accepted by the University of Alberta are successfully commercialized. ...
... Run program . User's guide . Launching program . Input data format . ... Selecting the number of correlated pairs . ... In order to run thr program one needs Java 5.0 environment. ... At the end of computations one will be asked to review the selected number of correlated pairs. ... Note: One may redefine the number of correlated pairs by selecting the 'Edit' -> 'redefine correlated pairs number' menu item. Correlated pairs of positions are presented as a colored matrix, the heatmap. ...
Генетическая кристаллохимия . ... Исследуются причинно-следственные связи структурных преобразований в гомологических и морфотропных рядах минералов. ... На примере минеральных групп фосфатов, боратов, силикатов, ванадилфосфатов и борофосфатов прослеживаются пути формирования и преобразования кристаллических структур минералов в породах различных геохимических типов . ... Типоморфизм минералов. ... Якубович О.В., Урусов В.С. Генетическая кристаллохимия фосфатов гранитных пегматитов // Вестник МГУ. ...
... Geography of World Economy . ... Field stations . ... Type of field courses . ... Khibiny station . ... Arkhangelsk station . ... The Arkhangelsk (Ustiayansk) research and training field environmental station is located in Ustiayanskyi district of the Arkhangelsk Region in the interfluve area of Vaga and Northern Dvina rivers. ... Emelianova L.G., Goriayinova I.N., Miaylo E.G. The Life of Taiga (Ecological Excursions in Ustiayanskyi district of the Arkhangelsk Region) M., Arkhangelsk. 1999. 162 pp. ...
О КАФЕДРЕ . ... Трухин В. И. Жиляева В.А. Жиляева А. И. Петрунин Г. И. Список публикаций ћСписок статей . ... Бобров А. В., Жиляева А. И. Минеральные ассоциации включений в гранатах из кимберлитовых трубок Мир и Сытыканская (Якутия) //Вестник НСО. ... A. Zhilyaeva, L. Leonyuk, G.-J. Babonas, G. Bocelli, S. Demishev, N. Leonyuk, V. Maltsev, A. Reza. ... Трухин В.И., Жиляева В.А., Жиляева А.И. Вязкая намагниченность (VRM) базальтов тройственного сочленения Буве (Южная Атлантика) // Физика Земли. ...
... Microstructure deeply influences the properties and thus the functionality of a material. In an X-ray diffraction pattern, the microstructure information is usually extracted from the breadth and shape of line profiles. ... Доклад ?Structure/microstructure and their interplay in nanomaterials and layered systems? оказался очень полезным и интересным для ученых, работающих в области неорганического синтеза и физико-химических методов исследования. ...
... David Kirk/NVIDIA and Wen-mei W. Hwu , 2007-2012 ECE408/CS483, University of Illinois , Urbana-Champaign 14 CUDA Device Memory Management API functions · cudaMalloc() Allocates object in the device global memory Two parameters · Address of a pointer to the allocated object · Size of of allocated object in terms of bytes ( Device ) Grid Block (0, 0) Block (0, 1) Registers Registers Registers Registers · cudaFree() Frees object from ...
[
Текст
]
Ссылки http://ccoe.msu.ru/sites/default/files/presentations/MSU-Lecture-CUDA-Intro-2012.pdf -- 1008.0 Кб -- 25.10.2012 Похожие документы
... Using Ar clusters accelerated by 30 kV, with a dose of ° ° 6 · 1014 e cmю2, we have effectively removed an asperity that was 3500 A wide and 350 A high. Subsequent processing ° ° with 5 kV acceleration reduced the surface roughness from an Ra value of 13.2 A to 4.8 A. This demonstrates the effectiveness of GCIB for reducing sub-micron roughness to atom level smoothness. с 2005 Elsevier B.V. All rights reserved. ... Technique and results Fig. 1 shows schematically the GCIB beamline [2]. ... Fig. ...
[
Текст
]
Ссылки http://danp.sinp.msu.ru/Articles_GSIB/nimb_GCIB_Ar_Smoothing_Swenson.pdf -- 263.6 Кб -- 07.10.2005 Похожие документы
... Study of the Russian " Silver Age " neology . ... Dictionaries of neologisms constitute an important part of lexicography. ... The peculiarity of our project is the full scope of text (at least published) considered and uniformity of description: dictionary entries of all the authors’ neologisms have the same format (suggested for Khlebnikov’s neology). ... Khlebnikov's neology (N. N. Pertsova). In 1995 "The Dictionary of Khlebnikov's Neologisms" was published. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...
... В лабораторных работах с использованием программной модели WPF надо создать пользовательский интерфейс для работы с данными классов из лабораторных работ предыдущего семестра. ... Элементы XML. ... Синтаксис элемент-свойство для коллекций. ... Класс ItemsControl - базовый класс элементов управления для работы с коллекцией. ... Классы архитектуры элемента управления DataGrid в WPF. ... Создание пользовательского интерфейса приложения с использованием классов WPF для классических элементов управления....
[
Текст
]
Ссылки http://lmph.cs.msu.su/Lekcii_files/UI_Prog.doc -- 79.5 Кб -- 16.11.2011
[
Текст
]
Ссылки http://lmph.cmc.msu.ru/Lekcii_files/UI_Prog.doc -- 79.5 Кб -- 16.11.2011 Похожие документы
... Alexey Garber Moscow State University April 17, 2010 A. Garb er (MSU) Quasicrystals April 17, 2010 1 / 33 Ё This work is a joint work with Dirk Frettloh from Bielefeld University. A. Garb er (MSU) Quasicrystals April 17, 2010 2 / 33 Separated net Definition A subset A of metric space M is called separated net if for some constants r and R following condition holds: for every two points x1 , x2 A distance dM (x1 , x2 ) r and for every point y M dM (y , A) R . ...
[
Текст
]
Ссылки http://higeom.math.msu.su/people/garber/talks/2010Texas.pdf -- 417.6 Кб -- 27.10.2013 Похожие документы
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... Крол Э. Все об Internet. Киев: BHV, 1995. 591с. Кент П. Internet. М.: Компьютер, 1996. 368с. Кент П. World Wide Web. М.: Компьютер, 1996. 312с. Хоникатт Дж. Internet Windows-95. М.: Бином, 1996. 334с. Хоникатт Дж. Использование Internet. ... СПб.: 1997. 185с. Айзекс С. Dynamic HTML. СПб.: ... BHV, 1998. 1040с. Ланг К., Чоу Д. Публикация баз данных в Интернете. ... М.: Бином, 1996. 336с. Бакулин П.И., Кононович Э.В., Мороз В.И. Курс общей астрономии. ...
... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...
To use Microsoft Outlook Web access, browser settings must allow scripts to run. ... If your browser does not support scripts, you can download Microsoft Internet Explorer for access to Outlook Web Access. ... Select this option if you use Outlook Web Access on a public computer. ... This is a private computer . ... Use Outlook Web Access Light . ... Type the address for Outlook Web Access into the field, click Allow, and then click OK to save your changes. Connected to Microsoft Exchange . ...