... Scientific laboratories . ... lheat@cs.msu.su . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty, rooms 625 (Head of the laboratory), 657, 658, 687 . ... Petrova Ludmila, Senior Research Fellow, PhD . ... Numerical modeling of jet and shock-wave processes on the basis of the Euler equations. ... 3, June 2012. ( http://dx.doi.org/10.5539/jmr.v4n3p00 , ISSN 1916-9795 E-ISSN 1916-9809). ... 2012 . ... CMC MSU students at GSIS Summer School, Tohoku University, Japan...

Еще в разделе: (Показать все результаты (>231) - en.cs.msu.ru/ )

• Laboratory of Computational Electrodynamics | CMC MSU
• International project INARM of EU program Tempus-IV | CMC MSU
• Laboratory of Statistical Analysis | CMC MSU

Moscow, Russia September 19-20, 2013 Submission Deadline: March 31, 2013 Program Chairs: Seung Ho Sam Park, SKOLKOVO Business School and Alexander Settles, Faculty of Management , National Research University Higher School of Economics Conveners: Nikolay Filinov, Dean, Faculty of Management , National Research University Higher School of Economics, Andrei Volkov, Dean, SKOLKOVO Business ...

Еще в разделе: (Показать все результаты (>500) - www.mgubs.ru/ )

• Преподаватели ВШБ МГУ Сергей Заверский и Наталья Чуркина выступили на

... research | ... Matvey Viktorovich Youdov . ... Organic Chemistry Division, Chemistry Department, Lomonosov Moscow State University, Leninskie Gory, 199899 Moscow, Russia. ... B.S./M.S. in Chemistry "Study of structure of humic substances and their hydrolysis products by 1H and 13C nuclear magnetic resonance spectroscopy techniques" Employment: . ... Current research activity is dealing with investigation of structure of hydrolyses products of humic substances by methods of NMR spectroscopy. | ...

Еще в разделе: (Показать все результаты (>8) - www.mgumus.chem.msu.ru/ )

... Research objects and scientific purposes . Space scientific program includes development and launch of two supersmall spacecrafts "Universitetskiy" and "Kompas-2" intended for monitoring of radiation conditions near the Earth. ... All the studies conducted in the near-Earth space are characterised by strong radiation fields. ... The circular polar orbits, which cover all the near-Earth space, are the most favorable for comprehensive studies of the radiation conditions near the Earth. ...

Еще в разделе: (Показать все результаты (>6701) - cosmos.msu.ru/ )

• University Satellites and Space Science Education '2006

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . tags . Правка . Недавние изменения . Настройки . On the right you can see the tag cloud for this blog. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:16 2015

Еще в разделе: (Показать все результаты (>5) - cell.biophys.msu.ru/ )

The work is supported by the Russian Foundation for Basic Research, grant 10-07-00685-a . PDB . ... Domain instances . ... TRANSCRIPTION/DNA . ... VIRAL PROTEIN/DNA . ... total (21 entries) . ... No comments on this family . ...

Еще в разделе: (Показать все результаты (>190) - monkey.belozersky.msu.ru/ )

• PDB entries containing domains of the family "Sigma-70, region 4"
• PDB entries containing domains of the family "XPG I-region"
• Hydrophobic clusters

... Поиск по МГУ | Лента новостей | ... О проекте . ... Please, enter the code that you see below in the input field. This is for blocking bots that try to post this form automatically. If the code is hard to read, then just try to guess it right. If you enter the wrong code, a new image is created and you get another chance to enter it right. ... 2003 2011 MsuNews.Ru Новости МГУ . 2003 2011 Разработка и дизайн MMForce.Net . ... Экспорт новостей (RSS) ...

Еще в разделе: (Показать все результаты (>29) - www.msunews.ru/ )

• MsuNews.Ru | Новости МГУ
• MsuNews.Ru | Блог проекта
• MsuNews.Ru | Энциклопедия

Roman Sutormin rsutormin@gmail.com Professional experience 05/2013 ґ present: Lawrence Berkeley National Laboratory (Berkeley, CA, USA) Software developer Development of JSON based storage system used for keeping biological data involved in public KBase services. ... 10/2009 ґ 08/2011: Mail.Ru Group (Moscow, Russia), Software developer Support and development of data warehouse (PostgreSQL) and administration web tool (JBoss + GWT) on serverside of MMO game "Allods Online". ... 2013 Jul 1514(1):476. ...

Еще в разделе: (Показать все результаты (>14) - storage.bioinf.fbb.msu.ru/ )

• http://storage.bioinf.fbb.msu.ru/~roman/Sutormin_CV_aug2013.pdf

... 9) Oknyanskij V.L. 1994, "Optical-radio time delays in Q0957+561", Odessa Astronomical Publ., ... 11) Oknyanskij V.L. 1994, "Connection between X-ray and optical variability in NGC4151", in Proceedings of Int. Conf. ... 1994. 12) Oknyanskij V.L. 1994, "Connection between X-ray and optical variability in NGC4151", Astrophys. and Space Science, 222, p.157. ... 14) Oknyanskij V.L., van Groningen E., 1997, "Optical spectral variability of NGC4151 in 1990", Astronomical and Astrophys. ...

Еще в разделе: (Показать все результаты (>22) - uranus.sai.msu.ru/ )

• Elena Seifina. Publications
• Igor Antokhin
• Tatjana Khruzina

THE 75th NAME-LIST OF VARIABLE STARS. ... The 75th Name-List consists of two tables. ... the literature, taken from positional catalogues, including USNO A1.0/A2.0 and GSC, or determined by the authors); the range of variability (sometimes the column Min gives, in parentheses, the amplitude of light variation; the symbol ( means that the star , in minimum light, becomes fainter, than the magnitude indicated); and the system of magnitudes used ( P are photographic ...

Еще в разделе: (Показать все результаты (>36) - www.sai.msu.ru/ )

• Absolute proper motions of open clusters
• Отдел внегалактической астрономии: ГАИШ Extra-galactic astronomy Group
• Index of /groups/cluster/gcvs/digit/mdv

... Home Our Team Staff Gennady F. Voronin . ... Bio : Was born in Moscow region , USSR (1935). Graduated and post-graduated from the Moscow State University (1958 and 1960)., ... Work at the Department of Chemistry of the Lomonosov Moscow State University: Junior Research Fellow (1960), Senior Research Fellow (1966), Head of the research laboratory of Chemical Thermodynamics (1976 - present). ... Colloquium on 24.12.12 20 Dec 2012 . ... Laboratory of Chemical Thermodynamics . ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• Colloquium on 08.09.10 Laboratory of Chemical Thermodynamics
• Colloquium on 23.09.10 Laboratory of Chemical Thermodynamics
• BHP meeting Laboratory of Chemical Thermodynamics

May 12, 1998 NOTES from May 9, 1998: The format of the Solar Event Lists was changed to include a standard SEC style header. ... Please send comments and suggestions to sec@sec.noaa.gov # # Missing data: //// # # Edited Events for 1998 May 11 # # Event Begin Max End Obs Q Type Loc/Frq Particulars Reg# #------------------------------------------------------------------------------- 2560 A0146 //// 1225 HOL ... The UT day of the event's begin time is the UT day of the list. ...

Еще в разделе: (Показать все результаты (>13) - dbserv.sinp.msu.ru/ )

Neutrino telescope in Northern Hemisphere . ... about ANTARES . ... Division of General Nuclear Physics MSU . ... The First Joint Seminar MSU-ITEP about activity in ANTARES was held 8-9th of September 2010 in MSU Nuclear Physics Institute. ... 10:40 Status of ANTARES at MSU E. Shirokov . ... 11:15 Status of ANTARES M. Anghinolfi pdf . ... Prof. M. Anghinolfi (INFN, Genova) . ... Prof. M. Anghinolfi, prof. A. Rostovtsev (ITEP) and prof. A. Capone during coffee brake . ... MSU, Faculty of Physics, 2009. ...

Еще в разделе: (Показать все результаты (>19) - antares.sinp.msu.ru/ )

ARM . 12: Ї ARM 2 ARM Powered Products 3 ARM Ї 4 Ї ARM 32- . ARM : ґ Byte - 8 bits ґ Halfword - 16 bits ( ) ґ Word - 32 bits ( ) Ї ARM ґ 32-bit ARM Instruction Set ґ 16-bit Thumb Instruction Set 5 Ї ARM : ґ User : , ґ FIQ : , high priority (fast) ґ IRQ : , low priority (normal) ґ Supervisor : Software Interrupt instruction ґ Abort : ґ Undef : ґ System : , 6 User ARM Current Visible Registers Abo Und rtMod SVCMode IRQ ef Mode FIQ Mode e User ...

Еще в разделе: (Показать все результаты (>4) - lvk.cs.msu.su/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• ConClus
• Nhunt: program for nucleic acid sequence similarity search

... Karlsruhe Institute of Technology (KIT) . 76021 Karlsruhe/Germany . ... Most technological applications of crystalline materials are based on the modification of their microstructure (e.g. of their grain size and/or of the topology of different phases that may be present). ... Glasses with this microstructure will be called poly-glasses in analogy to poly-crystals). ... Professor , Institute of Materials Science, University . ... Founding Director and Senior Member of the Institute of New . ...

Еще в разделе: (Показать все результаты (>110) - www.chem.msu.ru/ )

... L Сd , Pol a nd ABOUT EFFECTIVE MODES METHOD FOR DESCRIPTION OF INTERNAL DYNAMICS OF WEAKLY BOUND CLUSTERS Elena Belega, Evgeny Cheremukhin 1 , Dmitry Trubnikov Abstract: New approach to describe the internal dynamics of weakly bound clusters is presented. ... It is found that the number of active collective modes depends on the initial cluster excitation and that the internal energy is partitioned nonuniformly among the modes. ... Collective motion of oxygen atoms performs mostly in plane. ...

Еще в разделе: (Показать все результаты (>24) - beams.chem.msu.ru/ )

Nuclear Instruments and Methods in Physics Research B 206 (2003) 842ґ845 www.elsevier.com/locate/nimb Modeling of surface smoothing process by cluster ion beam irradiation A. Nakai c a,* , a T. Aoki a,b , T. Seki a,b , J. Matsuo a, G.H. Takaoka a, I. Yamada b,c Ion Beam Engineering Experimental Laboratory, Kyoto University, Sakyo, Kyoto 606-8501, Japan b Collaborative Research Center for Cluster Ion ... Smoothing rate depends on the wave number as well as the ion dose. ...

Еще в разделе: (Показать все результаты (>109) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Articles_GSIB/nimb206_855_Yamada_B-ClasterIons.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb206_838_Yamada_GCIB_CollisionsSolid.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb206_861_clasterionsize_Yamada.pdf

Gamma-quanta from SNRs V.N.Zirakashvili Pushkov Institute of Terrestrial Magnetism, Ionosphere and Radiowave Propagation, Russian Academy of Sciences (IZMIRAN), 142190 Troitsk, Moscow Region, Russia Outline Ї Acceleration of particles at forward and reverse shocks in SNRs Ї Amplification of magnetic fields Ї Modeling of broad-band emission Ї Radioactivity and electron acceleration Diffusive Shock ... 2010) . ... Cosmic ray positrons can be accelerated at reverse shocks of SNRs. ...

Еще в разделе: (Показать все результаты (>7) - tunka.sinp.msu.ru/ )

• http://tunka.sinp.msu.ru/en/presentation/horns_vhe.pdf

... handle = printer_open(); printer_start_doc($handle, "My Document"); printer_start_page($handle); $pen = printer_create_pen(PRINTER_PEN_SOLID, 2, "000000"); printer_select_pen($handle, $pen); $brush = printer_create_brush(PRINTER_BRUSH_SOLID, "2222FF"); printer_select_brush($handle, $brush); printer_draw_rectangle($handle, 1, 1, 500, 500); printer_delete_brush($brush); printer_delete_pen($pen); printer_end_page($handle); printer_end_doc($handle); printer_close($handle); . ...

Еще в разделе: (Показать все результаты (>146) - oit.cmc.msu.ru/ )

• SWFTextField->setrightMargin
• printer_draw_pie
• String Operators