... Форумы > Разное > Тема . Автор темы Dr.Neurosurgus . Форумы Список тем Новая тема . ... Publication/Reference Managers . ... чем народ пользуется, чтобы не утонуть в базе ссылок по публикациям по своей теме? . не одними же Reference Manager и ProCite . ... http://forum.khamenya.ru . Ответить Цитировать . ... на сцайнтифике в general форуме . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>110) - www.mmonline.ru/ )

• До 1 ноября Springer предоставляет бесплатный доступ к более чем 150
• MMOnline | Форумы | Разное
• MMOnline | Форумы | Аспирантура | Аспирантура ин-т Макса Планка / ун-т

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

Еще в разделе: (Показать все результаты (>9) - cellbiol.genebee.msu.ru/ )

... About CIE MSU . Academic Programmes . Admissions . ... Vestnik CIE (in Russian) . FAQs (in Russian) . ... Center For International Education . ... Documents Confirming Academic Background . Students having the school completion certificates and the secondary school matriculation certificates received abroad are to get nostrification certificate for these documents. ... 4. two copies of notarially certified translation into Russian of the documents on education and appendices to it. ...

Еще в разделе: (Показать все результаты (>15) - www.cie.ru/ )

• Apply Online

Kluwer Academic Publishers, attn. Annelies Kersbergen, P.O. Box 17, 3300 AA Dordrecht, The Netherlands, Telephone: (0)78-6576215, Telefax (0)78-6576388 Consent to Publish & Transfer of Copyright | For the mutual benefit and protection of Authors and Publishers it is | ... written Consent to Publish and Transfer of Copyright before publication of the| Work. The signed Consent ensures | that the Publisher has the Author's permission to publish the relevant | Contribution. ...

Еще в разделе: (Показать все результаты (>131) - mgumus.chem.msu.ru/ )

• MGUMUS -- Researches
• MGUMUS -- Contacts
• MGUMUS -- Irina V. Perminova

... Home Resources Publications Agricultural markets and global state of food.. ... Since the beginning of the 2000s the situation in the global agro-food market is characterized by the upward trend against the background of price volatility. The increase in consumption in developing countries, especially China and India, along with rising incomes and a shift in demand for more nutritious foods are some of the factors that determine the long-term increase in demand for agricultural commodities. ...

Еще в разделе: (Показать все результаты (>61) - ecfs.msu.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>219) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>53) - monkey.belozersky.msu.ru/ )

• S publications
• Homeodomain numeration assumed
• About authors ot this complex

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... Unless in many other approaches to the analysis of different signal coupling, the information entering the analysis of synchronization in our approach is explicitly represented in the form of elementary, instantaneous events (the change-points). ... Hence the use of correlation/coherency estimates in parallel with change-point analysis seems to be quite rational. ...

Еще в разделе: (Показать все результаты (>41) - brain.bio.msu.ru/ )

• Publications of the Lab. for Neurophysiology and Neuro-Computer Interfaces,

New Series of Historical Publications from the MSU Press . In 1998, the History Faculty of Moscow State University inaugurated a new series of publications designed to promote the results of recent research efforts and the teaching experience of our Faculty members and Departments. It is our intention that with these editions a clearer understanding of the Faculty, its current research orientations and mission, may be communicated. ... New Series of Editions . ...

Еще в разделе: (Показать все результаты (>7) - www.hist.msu.ru/ )

• Editions

... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...

Еще в разделе: (Показать все результаты (>8) - vernov-relec.sinp.msu.ru/ )

... О факультете . Структура факультета . ... Научная работа . ... Коллеги, у Вас есть возможность публиковать научные статьи в Peer-Reviewed Open Access Journals: . Журнал ?Международные научные публикации: Экология и Безопасность (ISP:ES), Том 5, ISSN: 1313-2563 . Журнал ?Международные научные публикации: Материалы, Методы и Технологии (ISP:MMT), Том 5, ISSN: 1313-2539 . ... Д 501.001.20 - все защиты . ... все защиты ? ... Биологический факультет МГУ . ... 2016 Биологический факультет . ...

Еще в разделе: (Показать все результаты (>4) - www.bio.msu.ru/ )

• Master In Ecology ? Биологический факультет МГУ

P.V.Korolenko, N.N.Fedotov, V.F.Sharkov. Main properties and potential practical applications of M-mode lasers. ... T.I.Arsenyan, P.V.Korolenko, E.A.Kuliagina, N.N.Fedotov. ... T.I.Arsenyan, N.N.Fedotov, L.S.Kornienko, P.V.Korolenko, E.A.Kulyagina, G.V.Petrova Laser beams with helical wavefront dislocations and their applications in the diagnostical and metrological systems. // 5-th International Conference "Industrial Lasers and Laser Applications '95" (Shatura, Moscow reg., ...

Еще в разделе: (Показать все результаты (>5) - optics.sinp.msu.ru/ )

O.A. Aktsipetrov, E.A. Gan'shina, V.S. Guschin, T.V. Misuryaev, T.V. Murzina. Magneto-induced second harmonic generation and magneto-optical Kerr effect in Co-Cu granular films. ... A.A. Fedyanin, T.V. Misuryaev, T.V. Murzina, and O.A. Aktsipetrov. ... O.A. Aktsipetrov, A.V. Melnikov, T.V. Murzina, A.A. Nikulin, A.N. Rubtsov DC-electric-field-induced optical second harmonic generation at the smooth metal-electrolyte interface // Surf. ...

Еще в разделе: (Показать все результаты (>32) - shg.phys.msu.ru/ )

• All Publications Info Pad
• Publications Keywords Search
• List of Publications

... Khmelev D.V. Reconstruction of linear index expressions for reducing programs to a linear class//Zhurnal Vychislitel'noi Matematiki i Matematicheskoi Fiziki. ... Khmelev D.V. Limiting theorems for asymmetrical transportation networks//Fundamental and Applied mathematics, 2001, vol.7, no.4, pp. ... Khmelev D.V. Markov chains and classification of text passages. (in Russian) [Raspoznavaniye avtora teksta s ispol'zovaniyem cepei A.A. Markova] Vestnik MGU, Ser.9:Philologiya, No 2, 2000, pp. ...

Еще в разделе: (Показать все результаты (>35) - old.philol.msu.ru/ )

• Our publications

... Search for Single Top Quark Production at DZero using Neural Networks" . ... Search for Single Top Quark Production at D0 Using Neural Networks" . ... Search for Electroweak Production of Single Top Quarks" . ... Use of Neural Networks in a Search for Single Top Quark Production at D0", . ... Search for Single Top Quark Production at the Tevatron" . ... Use of Neural Networks in a Search for Single Top Quark Production with the DZero Detector at the Fermilab Tevatron Collider", . ...

Еще в разделе: (Показать все результаты (>10) - top.sinp.msu.ru/ )

• Lev V. Dudko Home Page
• autoref

.

Еще в разделе: (Показать все результаты (>4) - lab110.imec.msu.ru/ )

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>131) - mccmb.belozersky.msu.ru/ )

• MCCMB'15 - OpenConf Peer Review & Conference Management System

.

Еще в разделе: (Показать все результаты (>38) - www.chemport.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>20) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• Nhunt: program for nucleic acid sequence similarity search

... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...

Еще в разделе: (Показать все результаты (>10) - en.fbb.msu.ru/ )

• Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University
• BackgroundтАФ Faculty of Bioengineering and Bioinformatics, MSU