... Russian language courses: During academic year Summer courses Full-time Part-time Courses dates: from _____( day )____________( month )_____( year ) to ____( day )___________( month )______( year ) Information for visa support Citizenship __________________________________________(if more than one, please indicate them using comas) Place of birth ____________________________( country )_______________________________________ ____( ...

Еще в разделе: (Показать все результаты (>131) - www.msu.ru/ )

• Specialist studies
• Master studies
• Bachelor studies

In order to assist folks upgrading we are now going to maintain a document describing information critical to existing Apache users. Note that it only lists differences between recent major releases, so for example, folks using Apache 1.1 or earlier will have to figure out what changed up to Apache 1.2 before this document can be considered relevant. Old users could look at the src/CHANGES file which tracks code changes. ... There have been numerous changes to the default config files. ...

Еще в разделе: (Показать все результаты (>81) - neptun.sai.msu.ru/ )

• Apache Tutorial: .htaccess files
• Apache module mod_auth_anon.c
• Definitions of terms used to describe Apache modules

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Poligraphic complex (printing plant) - humanitarian aid from RRU to South Ossetia A.A. Tibilov State University The printing plant is intended to make a wide range of materials - textbooks, manuals, presentations, reports, informational and commercial printed matters. ... wide color range, surpassing that of offset printing; . ... simple operation and high reliability. [pic] Besides the printer, there is a digital color copier Duplo DPS850 (Japan) size A3, in the printing complex. ...

Еще в разделе: (Показать все результаты (>37) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/273.doc

... MSU's HPC HISTORY . ... In 1956, Research Computing Center (RCC) of Moscow State University received its first computer тАЬStrelaтАЭ. ... BESM-6 computer was and still is considered to be of great importance to USSRтАЩs/RussiaтАЩs history of computer development. ... Same year RCC received its first BESM-6 computer, and despite its serial number 13 it proved to be lucky for the Center. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Excursions to Supercomputing Center ...

Еще в разделе: (Показать все результаты (>29) - hpc.msu.ru/ )

• Supercomputing Education Project | Moscow University Supercomputing Center

... I. Bogdanova, R. F. Galeevb, S. P. Kulikb, and E. V. Morevac a Institute of Physics and Technology, Russian Academy of Sciences, Moscow, 117218 Russia b Faculty of Physics, Moscow State University, Moscow, 119992 Russia c Moscow Engineering Physics Institute (State University), Moscow, 115409 Russia Received October 12, 2006 Abstract--A model that approximately takes into account instrumental errors in problems of precision reconstruction of quantum states is considered. ...

Еще в разделе: (Показать все результаты (>66) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2006-pra-73-063810.pdf
• http://qi.phys.msu.su/papers/2007-nato-11-123.pdf
• http://qi.phys.msu.ru/papers/2010-prl-105-010404.pdf

... 10, 63 ­ 64 (2010) / DOI 10.1002/pamm.201010024 Integrability and nonintegrability in terms of transcendental functions in dynamics of a rigid body Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., ... This circumstance allowed the author to perform a complete analysis of all phase trajectories and highlight those properties of them which exhibit the roughness and preserve for systems of a more general form. c 2010 Wiley-VCH Verlag GmbH & Co. ...

Еще в разделе: (Показать все результаты (>40) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-136-1.pdf
• http://shamolin2.imec.msu.ru/art-115.pdf
• Maxim V. Shamolin Home Page

... Diffusion diagnostics of microporosity in nanoporous amorphous silicas and porous glasses . ... Trimodal nanoporous structure of silicas and porous glasses consists essentially of transporting mesopores with mean diameter from 3 to 15 nm and two kinds of adsorbing micropores with diameter 0.3-0.4 and 0.6-0.7 nm what corresponds 1 and 2 diameters of gas molecules. ... Gas adsorption in micropores has a character of volume filling. ... The mechanism of diffusion in micropores is surface-diffusion one....

Еще в разделе: (Показать все результаты (>12) - www.kge.msu.ru/ )

... E-journal. Public Administration" was first published online in 2003. ... International serial number of the magazine is ISSN 2070-1381 . ... Founding organization: Federal State Budgetary Institution of Higher Professional Education Lomonosov Moscow State University . Publisher: School of Public Administration, Lomonosov Moscow State University . The goal of E-journal. ... 119991, Room A-710, Shuvalovskiy building, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>97) - ee-journal.spa.msu.ru/ )

Academic English Part 4 of 4 Sources: 1. ... Cambridge University Press Unit After · · 51 completing the tasks the students will: Learn about US system for higher education in science Learn some communicative strategies they might use when asking for help or information from colleagues · Learn to write a CV and participate in an interview · Revise their reading strategies · Revise their summarizing strategies Camb 1. 2. 3. 4. ridge English for Scientists, Unit 1, pp.6-7 all ...

Еще в разделе: (Показать все результаты (>24) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Model_rendering_scheme_and_connectives.pdf
• http://www.eng.math.msu.su/download/dictionary.pdf

pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological ... Teaching and learning a foreign language at a distance. ...

Еще в разделе: (Показать все результаты (>4) - dist.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр дистанционного обучения.

... education . ... Composite materials . Materials for solar and fuel cells . ... Registration deadline is 30 April 2012. ... New deadline is 15 May 2012 . ... Registration fee should be paid before 10 June 2012. ... For information please contact Mrs. Olga Bogomolova: obogomol@gmail.com and Dr. Alexander Chertovich: chertov@polly.phys.msu.ru . ...

Еще в разделе: (Показать все результаты (>17) - nano.msu.ru/ )

• Registration for the International School ?Computer simulation of advanced
• The 7th International Nanoscience Student Conference, London, 19?22 August 2013
• Schools | MSU Nanotechnology Education and Research Center

... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . Final program Accommodation Program committee Organizing committee . ... V Moscow International Conference . on Operations Research, . ... ORM2007) . Moscow, April 10-14, 2007 Registration . ... Fatal error : Call to undefined function import_request_variables() in /wcmc/io/io/ORM2007/reg.php on line 18 . ...

Еще в разделе: (Показать все результаты (>11) - io.cs.msu.ru/ )

... People . ... EVENKI-SELKUP EXPEDITION 2010 . ... During the fieldwork (31days including transportation) the participants worked with native speakers, half-speakers and quarter-speakers of the autochthonous languages of the region representing the Sym dialect of Evenki, the Ket and Tym dialects of Selkup and the Vasiugan dialect of Khanty for more than 300 hours. ... One Selkup full-speaker, one Selkup half-speaker . ... No one speaks Selkup, 5 to10 people remember some Selkup words or expressions . ...

Еще в разделе: (Показать все результаты (>10) - lcl.srcc.msu.ru/ )

О факультете . ... 15 марта 2016 года декан биологического факультета Михаил Петрович Кирпичников стал лауреатом премии имени А. А. Баева. ... 27 марта 2016 года, в рамках общеуниверситетского дня открытых дверей, прошел день открытых дверей на биологическом факультете. ... 11- 15 апреля 2016 года на Биологическом факультете пройдет конференция Ломоносов-2106, секция Биология. ... Срок обучения на биологическом факультете в бакалавриате 4 года, в магистратуре 2 года. ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>9) - www.bio.msu.ru/ )

Create user account [Комиссия по практикуму, 3 семестр, 2015-2016] . login: . e-mail: . ... Use an existing account . To create an account, please think out, a login and provide your valid e-mail address in the form above. Then press the \"Create account\" button. Login may contain only latin letters, digits, . ... Use this password for the first log in. ... If you already have an ejudge account on this server, you may use it. If so, follow the link: Use an existing account . ...

Еще в разделе: (Показать все результаты (>18) - acm.msu.ru/ )

• Log in to edit registration data [Комиссия, 3 семестр, 2014-2015]
• Log in to edit registration data [Комиссия, 4 семестр, 2014-2015]
• Log in to edit registration data [ACM ICPC 2015-2016, NEERC, Moscow Subregion,

... E-mail: Tchytannya@gmail.com Website of the Conference: www.tchytannya.org.ua Mailing address: National University "Law Academy of Ukraine named after Yaroslav Mudriy", Department of the Constitutional Law of Ukraine, organizing committee of The International Science Conference of Young Scientists, Researchers, Postgraduates and Students "Values of modern constitutionalism (V Todyka's readings)" Pushkinska street, 77, Kharkiv, 61024, Ukraine. ...

Еще в разделе: (Показать все результаты (>5) - www.law.msu.ru/ )

The M.V. Lomonosov Moscow State University is organizing a traditional International Conference "BIOCATALYSIS-2007" in 17-22 June 2007 (preliminary dates were changed). ... Structure, catalytic mechanism and protein engineering of enzymes. ... EURO . ... In view of a limited number of ship cabin passengers, the Organizing Committee is asking to apply for participation at BIOCATALYSIS-2007 Conference, to send the Abstracts and to pay the Registration Fee not later than the deadlines indicated above. ...

Еще в разделе: (Показать все результаты (>100) - www.enzyme.chem.msu.ru/ )

• On-line registration
• proj_past

. Источники: . 226 Ra . Неизвестные . 1 . 2 . 3 . 4 . Масшаб по Y: . 32 64 128 256 512 1024 2048 4096 8192 16384 32768 65536 . Время измерения . 1 2 3 4 5 6 7 8 9 10 50 100 сек . alt=" Your browser understands the APPLET> tag but isn't running the applet, for some reason." Your browser is completely ignoring the APPLET> tag!

Еще в разделе: (Показать все результаты (>115) - nuclphys.sinp.msu.ru/ )

• Определение периода полураспада и сечения взаимодействия тепловых нейтронов
• Определение расстояния между источником и детектором
• Определение толщины пластин

... Научно-методический совет по иностранным языкам . ... Факультет иностранных языков и регионоведения . МГУ им. М.В. Ломоносова. Центр Дистанционного Образования . ... The Scientific and Methodological Council on Foreign Language Teaching . ... в обучении иностранным языкам и межкультурной коммуникации", . которая состоится 7-8 июня 2006 г. на базе . факультета иностранных языков и регионоведения . ... Дидактические принципы дистанционного обучения иностранным языкам; . ...

Еще в разделе: (Показать все результаты (>17) - anazarenko.ffl.msu.ru/ )