... Кафедра математического моделирования и информатики . ... Добро пожаловать на сайт кафедры математического моделирования и информатики , заведующий кафедрой ? ... студент младших курсов и хотите делать у нас курсовую или поступать к нам, ознакомьтесь с основными направлениями деятельности кафедры и предлагаемыми темами курсовых работ. Может быть, вам нужны материалы по программированию , теории вероятностей , специальным курсам или математическим дисциплинам по выбору . ... Программирование . ...

Еще в разделе: (Показать все результаты (>6) - cmp.phys.msu.ru/ )

• Welcome! | Chair of Computer Methods of Physics
• User account | Chair of Computer Methods of Physics
• Contacts | Chair of Computer Methods of Physics

The most up-to-date information related to atmos 3.0 are collected here due to constantly increasing interest to MASS/DIMM processing software... atmos 3.0 is still beta , so the latest version is 2.97.5 (there is also 2.98.x branch which absorbs new features) . ... M' line: . ... free seeing and its relative error . ... dimm seeing and its relative error (if dimm data are present, zeros otherwise) . ... dimm turbulence power and its relative error (if dimm data are present, zeros otherwise) . ...

Еще в разделе: (Показать все результаты (>22) - curl.sai.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... OPERA main features: 1) long baseline, 2) high neutrino energy, 3) Kton detector mass , 5) detect short lived taus produced in tau neutrino interactions L = 730 km CERN T flight = 2. 44 m s LNGS Expected neutrino interactions for 22.5x1019 pot: ~ 23600 µ CC + NC ~ 160 e + e CC ~ 115 CC (m2 = 2.5 x 10-3 eV2) 2 CNGS neutrino beam performances 2006 2007 2008 2009 2010 0.076x1019 pot 0.082x1019 pot 1.78x1019 pot 3.52x1019 pot 1.74x1019 pot (19 July) Commissioning ...

Еще в разделе: (Показать все результаты (>79) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2015/Qfthep_mTCA_PVolkov.pdf
• http://qfthep.sinp.msu.ru/talks2011/APopov_doklad.pdf
• September 14, 2010

О лаборатории . ... Лаборатория теоретической биофизики . ... In our previous article (<a href=? http://erg.biophys.msu.ru/wordpress/archives/706 ? ... Here we generalize this technique for the љtwo-dimensional space. ... Let us demonstrate how the discrete Laplacian is used in explicit scheme of solving the reaction-diffusion system . ... Нет комментариев " Reaction-diffusion systems in 2D space with python " . ... Reaction-diffusion systems in 2D space with python . ... 2016 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>31) - erg.biophys.msu.ru/ )

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>71) - www.kosmofizika.ru/ )

... It is more convenient to study the process of perfect flora revealing on the objects with clear natural borders, such as islands and lakes. ... We also compared our floristic lists for the two islands of the Chupa bay with analogous lists, got in the beginning of August 2001 (White sea expeditions…, 2001; Abramova et al., 2003) to reveal the changes in islands flora during these five years. ... Different species were usually overlooked on the close islands with similar flora. ... Chupa bay islands ....

Еще в разделе: (Показать все результаты (>153) - herba.msu.ru/ )

• Systema Naturae
• Publications about flora
• Floristic changes on the Kem

The Fulbright Program in Russia . ... The Bureau of Educational and Cultural Affairs (ECA) of the United States Department of State is pleased to announce a new International Fulbright Science and Technology Award for outstanding foreign students. The award is designed to be among the most prestigious international scholarships in science and technology. The International Fulbright Science and Technology award is for PhD study at top U.S. institutions in science, technology, or engineering. ...

Еще в разделе: (Показать все результаты (>98) - www.prof.msu.ru/ )

• Institute of Civilization
• The Association for the Study of Nationalities
• ОСОБЕННОСТИ МИРОТВОРЧЕСТВА США, НАТО И ЗАПАДА В ЦЕЛОМ НА БАЛКАНАХ

... education . ... Composite materials . Materials for solar and fuel cells . ... Registration deadline is 30 April 2012. ... New deadline is 15 May 2012 . ... Registration fee should be paid before 10 June 2012. ... For information please contact Mrs. Olga Bogomolova: obogomol@gmail.com and Dr. Alexander Chertovich: chertov@polly.phys.msu.ru . ...

Еще в разделе: (Показать все результаты (>23) - nano.msu.ru/ )

• Registration for the International School ?Computer simulation of advanced

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia e­mail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the so­called V­ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY Y­MP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>7) - asa.guru.ru/ )

• Alexander Antonov's Resume

... Professors: Corresponding member of RAS S.A.Dobrolubov (water masses, ocean and atmosphere interaction), corresponding member of RAS S.K.Gulev (ocean and atmosphere interaction), academician of RAS A.S.Sarkisian (sea currents theory); . ... Data bases have been created: for Caspian Sea hydrological and hydrochemical observations in the second half of the XX century involving more than 70 thousands of oceanologic stations; for Black Sea about 60 thousands stations with thermohaline observations. ...

Еще в разделе: (Показать все результаты (>42) - eng.geogr.msu.ru/ )

• Geoecology of the Northern Territories

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... 21.04.2015 On March 27 April 3, 2015 Professor Owen Johnson (Indiana University, USA) delivered a series of lectures about the history and special features of Russian journalism.љ ... One of the points he gave particular attention to was the history of American journalists in Russia. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>62) - www.journ.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>8) - iconolat13.phys.msu.ru/ )

• Guidelines

... Географии мирового хозяйства . ... Гидрологии суши . ... Выберите кафедру . ... This is why it is very important for any home daycare owner to not only love children but to also have gone through the proper steps necessary to ensure that their home daycare is fit for children legally and not off the books. hollister sale Kurzban cites the agency's delay as further evidence of the hostility to the EB-5 program inside an agency that immigrants rely on to be fair and impartial arbiter of their cases. ...

Еще в разделе: (Показать все результаты (>214) - www.geogr.msu.ru/ )

• louis vuitton replica purse wholesale louis vuitton outlets cheap sales
• CONTENTS ? 4 - 2013
• hmokn

... Частичная проблема собственных значений . ... Частично . ... Partially immersed body . ... Частичное отображение . ... Doppler frequency shift . ... Number of specimens in the population . Число закрутки (потока) . ... A base two (ten) number . ... The Reynolds number based on the relative velocity between the droplet and the gas . ... Чисто геометрический характер . Purely geometric nature . ... The condition number of a matrix is a measure of sensitivity to perturbations of its elements . ...

Еще в разделе: (Показать все результаты (>159) - num-anal.srcc.msu.ru/ )

• Параллельные программы. ЛИТЕРАТУРА
• Поясняющие фразы
• БЧА НИВЦ МГУ. AMTSR_C. Транспонирование матриц

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>4) - bioinf.fbb.msu.ru/ )

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...

Еще в разделе: (Показать все результаты (>6) - ani.cs.msu.su/ )

• Учебные курсы ведущих университетов мира

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>13) - mph.cmc.msu.ru/ )

... UHECR SINP MSU . ... News . UHECR news . TLE news . Lab's news . ... Publications UHECR . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... Using the analytic modeling of the electromagnetic cascades compared with more precise numerical simulations we describe the physical properties of electromagnetic cascades developing in the universe on CMB and EBL background radiations. ... The new feature of the analysis is " E max rule". ... all news . ...

Еще в разделе: (Показать все результаты (>15) - uhecr.sinp.msu.ru/ )

• CRPropa 3 - a Public Astrophysical Simulation Framework for Propagating