... Contact information . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty . ... Our goal is to provide researchers from many branches of science, education and industry with innovative tools and methods for solving applied problems using the latest information technologies, modern methods of computation modeling and scientific visualization. ... The uncertainty can be used in further uncertainty estimation of a computational model that uses FetchClimate. ...

Еще в разделе: (Показать все результаты (>53) - en.cs.msu.ru/ )

• Research Laboratory of Computational Modeling Tools

... Geography of World Economy . ... Field stations . ... Type of field courses . ... Khibiny station . ... Arkhangelsk station . ... The Arkhangelsk (Ustiayansk) research and training field environmental station is located in Ustiayanskyi district of the Arkhangelsk Region in the interfluve area of Vaga and Northern Dvina rivers. ... Emelianova L.G., Goriayinova I.N., Miaylo E.G. The Life of Taiga (Ecological Excursions in Ustiayanskyi district of the Arkhangelsk Region) M., Arkhangelsk. 1999. 162 pp. ...

Еще в разделе: (Показать все результаты (>28) - eng.geogr.msu.ru/ )

• Khibiny teaching and research station
• Geoecology of the Northern Territories

О КАФЕДРЕ . ... Трухин В. И. Жиляева В.А. Жиляева А. И. Петрунин Г. И. Список публикаций ћСписок статей . ... Бобров А. В., Жиляева А. И. Минеральные ассоциации включений в гранатах из кимберлитовых трубок Мир и Сытыканская (Якутия) //Вестник НСО. ... A. Zhilyaeva, L. Leonyuk, G.-J. Babonas, G. Bocelli, S. Demishev, N. Leonyuk, V. Maltsev, A. Reza. ... Трухин В.И., Жиляева В.А., Жиляева А.И. Вязкая намагниченность (VRM) базальтов тройственного сочленения Буве (Южная Атлантика) // Физика Земли. ...

Еще в разделе: (Показать все результаты (>2) - geo.phys.msu.ru/ )

... Предыдущее сообщение: PARALLEL.RU - Новости, выпуск #263 [14/04/2009] . ... НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / news / + NVIDIA предоставляет пользователям OpenCL Driver. http ://www.nvidia.com/object/io_1240224603372.html + Psychsoftpc выпускает Psychlone Tesla Personal Supercomputer. http ://www.psychsoftpc.com/psychlone_tesla.htm + NSF финансирует участие 14 университетов в программе IBM/Google Cloud Computing University Initiative. http ://www.nsf.gov/ news...

Еще в разделе: (Показать все результаты (>16) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #261 [18/03/2009]
• PARALLEL.RU - Новости, выпуск #266 [27/05/2009]

... Microstructure deeply influences the properties and thus the functionality of a material. In an X-ray diffraction pattern, the microstructure information is usually extracted from the breadth and shape of line profiles. ... Доклад ?Structure/microstructure and their interplay in nanomaterials and layered systems? оказался очень полезным и интересным для ученых, работающих в области неорганического синтеза и физико-химических методов исследования. ...

Еще в разделе: (Показать все результаты (>2) - nano.msu.ru/ )

... October, 2005 . ... Moscow State University Russian Language Centre . Moscow State University . ... Learn Russian at the Moscow State University! ... You will not only learn Russian for your professional career, but also learn a lot about Russia and its people that will allow you to communicate with your Russian clients more efficiently. www.rlcentre.com . ... Europalia International welcomes the biggest country in the world to a new edition of its multidisciplinary and edifying festival. ...

Еще в разделе: (Показать все результаты (>7) - www.rlcentre.com/ )

On this page you will find a list of images of SN 1998bp which was found in NGC 6495 . ... M1 supernova search has a 1998bp page New 1/8/99 . M.Armstrong discovery image 4/29/98 . ... Spectroscopy has performed by ESO group and Harvard group: they report that SN 1998bp is of type Ia around the maximum, but peculiar. ... 3127 (A.Ap.Suppl, 113, 151 (1995)) ESO group 4500 These three indicate that NGC 6495 is not so near as Virgo cluster; it looks like about three or four times further than Virgo. ...

Еще в разделе: (Показать все результаты (>10) - www.rochesterastronomy.org/ )

• Supernova 2002bl in UGC 5499

... Study of the Russian " Silver Age " neology . ... Dictionaries of neologisms constitute an important part of lexicography. ... The peculiarity of our project is the full scope of text (at least published) considered and uniformity of description: dictionary entries of all the authors’ neologisms have the same format (suggested for Khlebnikov’s neology). ... Khlebnikov's neology (N. N. Pertsova). In 1995 "The Dictionary of Khlebnikov's Neologisms" was published. ...

Еще в разделе: (Показать все результаты (>9) - lcl.srcc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• ConClus

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>23) - www.msm.biophys.msu.ru/ )

Home . Data . ... Meteor-M тДЦ1 . ... Meteor-M тДЦ2 . ... Solar energetic particles . ... Solar flare database (RU) . ... Space Monitoring Data Center of SINP MSU (SMDC) collects the data of space experiments as well as scientific and applied models for studying the geomagnetic and radiation conditions in the near-EarthтАЩs space environment. ... Latest data from featured spacecrafts . Meteor-M #1 is alive! ... Space weather now . ... NOAA N3KL Solar Activity Monitor . ... Developed in 2007. ...

Еще в разделе: (Показать все результаты (>6) - smdc.sinp.msu.ru/ )

... About Space Monitoring Laboratory, scientific directions, instruments, contacts . ... В XXI веке в оптической астрономии появился новый мощный инструмент исследования Вселенной - синоптические обзоры или синоптические телескопы. ... Но если иметь в виду астрофизический объект вам обязательно понадобится спектральный телескоп, чтобы понять его физическую природу или установить его подтип. ... В основном спектральные телескопы имеют диаметры до 2-3 метров (таких телескопов в мире более 50). ... МАСТЕР...

Еще в разделе: (Показать все результаты (>7) - master.sai.msu.ru/ )

• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...

Еще в разделе: (Показать все результаты (>6) - phys.web.ru/ )

... Publications . ... SPDC Laboratory . Quantum Electronics Chair . ... Generation of Polarization Entangled States in Spatially Inhomogeneous Ferroelectrics?, Advanced Science Letters, 2 (4), 430?447 (2009). ... Download [ help ]: . ... Copyright notice: This material is presented to ensure timely dissemination of scholarly and technical work. ... All persons copying this information are expected to adhere to the terms and constraints invoked by each author's copyright. ...

Еще в разделе: (Показать все результаты (>36) - qi.phys.msu.ru/ )

QUANTUM STOCHASTIC PROCESSES This course is for 4-5th year and graduate students. ... It is dedicated to systematic account of Quantum Stochastic Processes right in the form they are actually used in theoretical calculations of Quantum Open Systems. ... LECTURE 2. ... Open systems and quantum stochastic processes. Mathematical definition of an open system and quantum stochastic process. ... Markovian quantum stochastic processes. Formal definition of quantum markovian stochastic process. ...

Еще в разделе: (Показать все результаты (>43) - qilab.phys.msu.ru/ )

• Quantum Information Lab, Int'l Laser Ctr. and Faculty of Physics, M.V.Lomonosov

1, 120102 (2012) 2D- - . ... 2D- - E-mail: kozlov@polly.phys.msu.ru 2012 120102-1 [4, 7], . ... 2D- - 1, 120102 (2012) 1D- , x n+1 . ... 5: (), ( ) P () a = 1.9 = 0.1 t = 10000 . ... 2] Kaneko K. Chaos. ... E-mail: kozlov@pol ly.phys.msu.ru In the field of synchronization processes coupled map lattices (CML) represent paradigmatic models of extended systems exhibiting spatiotemporal chaos, self-organization and synchronization due to the rich variety of global qualitative behavior. ... 2012 120102-8 ...

Еще в разделе: (Показать все результаты (>3) - uzmu.phys.msu.ru/ )

• http://uzmu.phys.msu.ru/issue/120103.pdf

... Chemical Department . ... 7 (495) 939-31-70, Fax: +7 (495) 939-31-70, +7 (495) 939-54-17 . ... 1999 - 2004 . Master's Degree, The M.V. Lomonosov Moscow State University, Chemical Faculty, Chemical Enzymology Department (2004) . ... Strong background in Chemistry (Biochemistry, Organic chemistry, Analytical chemistry, Inorganic chemistry, Physical chemistry, Chemistry of polymers, Radio-chemistry), biochemistry, molecular biology, Physics (course of Theoretical physics, the Theoretical mechanics) . ...

Еще в разделе: (Показать все результаты (>63) - www.enzyme.chem.msu.ru/ )

Химический факультет МГУ имени М.В. Ломоносова . КАФЕДРА НЕОРГАНИЧЕСКОЙ ХИМИИ . ... Неорганическая химия в ВУЗах России . ... Руководитель: Казин Павел Евгеньевич, д.х.н., профессор ( http://istina.msu.ru/profile/Kazin/ ). Местоположение: рекреация БХА (Химический факультет МГУ), +7 (495) 939 - 34 - 40, kazin @ inorg.chem.msu.ru . ... P.E. Kazin, M.A. Zykin, Y.V. Zubavichus, O.V. Magdysyuk, R.E. Dinnebier, M. Jansen. ... P.E. Kazin, L.A. Trusov, D.D. Zaitsev, and Yu.D. Tret'yakov. ...

Еще в разделе: (Показать все результаты (>27) - www.inorg.chem.msu.ru/ )

• List of research papers of Prof
• Inorganic Chemistry Division

Solar proton anisotropy and dropout effects in the polar cap and auroral zone during period of the extended substorm activity Kuznetsov S.N., and Lazutin L.L. Institute of Nuclear Physics, Moscow State University, Vorob'evy gory, Moscow, 119899 Russia Abstract. ... Dropout effects of the proton radial distribution were found suggesting specific field line stretching inside the magneosphere trapping region during period of extended substorm activity. ... Fig 1. ...

Еще в разделе: (Показать все результаты (>56) - www.kosmofizika.ru/ )

• http://www.kosmofizika.ru/pdf2/e_p_apatity08.pdf
• http://www.kosmofizika.ru/pdf2/ap_seminar06.pdf
• http://www.kosmofizika.ru/pdf1/abel_02b.pdf

ЭЛЕКТРОСТАТИЧЕСКИЕ СВОЙСТВА ПРОМОТОРНЫХ ПОСЛЕДОВАТЕЛЬНОСТЕЙ E.COLI И РАННИХ ОБЛАСТЕЙ ГЕНОМОВ ФАГОВ Т4 И Т7 . ... Рассчитан профиль распределения электростатического потенциала вокруг полной последовательности хромосомы E.coli, а также 359 фрагментов ДНК длиной 400п.н., содер-жащих промоторы E.coli, обозначенные на хромосоме как экспериментально подтвержденные, и промоторы ранних генов фагов Т7 и Т4. Проведен анализ особенностей электро-статических свойств промоторных и непромоторных областей ДНК. ...

Еще в разделе: (Показать все результаты (>9) - www.library.biophys.msu.ru/ )