... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

NATO Publishing Unit P.O. Box 17 3300 AA Dordrecht A U T H O R 'S D A T A B A S E E N T R Y S H E E T (to be submitted together with the scientific paper ) REFERENCE: ARW978587 TITLE OF THE NATO MEETING/ NATO ASI SERIES VOLUME : Use of Humic Substances to Remediate Polluted Environments: from Theory to Practice NAME OF THE DIRECTOR: Dr. Norbert ... The total space available for keywords and abstract of your paper is 900 characters (approx. 100 words). ...

Еще в разделе: (Показать все результаты (>83) - mgumus.chem.msu.ru/ )

. Загружено: Vovez . Дата загрузки: 05.03.2010 . Размер: 77.6 Кбайт . Подпись: no comments . Описание: ...

Еще в разделе: (Показать все результаты (>3) - www.dubinushka.ru/ )

All your comments please send to Yagola Anatoly ( yagola@prof.msu.ru ) or to web-deseigners of the site ( ill-posed@mail.ru , nataschka_@mail.ru ).

Еще в разделе: (Показать все результаты (>15) - foroff.phys.msu.ru/ )

... Anti thrombin DNA aptamers were immobilized on silica microspheres, placed inside microwells on the distal tip on an imaging optical fiber, coupled to a modified epifluorescence microscope through its proximal tip. ... It should be mentioned that since thrombin is not a DNA binding protein, the possibility to elicit thrombin­aptamer complexes clearly demonstrates the power of SELEX technology. ... Specificity of aptamer coated beads for F thrombin binding was assessed with bovine serum albumin. ...

Еще в разделе: (Показать все результаты (>4) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf
• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf

... Почему передовые технологии программирования представляют особый особый интерес для "суперпрограммирования". Generative Programming - передовая технологии программирования, позволяющая совмещать небольшие накладные расходы на разработку программ и высокую производительность получаемого при этом программного кода. ... Generative programming объединяет в себе аспекты и подходы метапрограммирования, Generic programming, объектно-ориентированного программирования и Domain Engineering. ...

Еще в разделе: (Показать все результаты (>36) - new.math.msu.su/ )

• Department: General Problems of Control. Faculty of Mechanics and Mathematics.
• Extra courses of the department | Department: General Problems of Control.
• Geometric methods in optimal control theory | Department: General Problems of

Programme of the International Congress Globalistics-2015 : Global Governance and Diplomacy in the Unstable World dedicated to the 70th anniversary of the UN and the Year of RUSSIA's Presidency ... 26th OCTOBER 09:3011:00 Registration of the participants of the International Scientific Congress Globalistics-2015 Venue : Intellectual Centre - Fundamental Library of Moscow State University, the 1st floor hall ... P-6 Address: Leninskie Gory, 1, b.51 (Metro "Universitet"). ...

Еще в разделе: (Показать все результаты (>1715) - fgp.msu.ru/ )

• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

... Do those millions of sites and services provide useful information, or are they just "information pollution"? ... Abstract This is a review of electrochemical information and services available on the internet, and some evaluation of their usefulness for professionals, students, and the general public. ... Two examples are the "Internetchemistry" site [26] and the "Electrochemical Science and Technology Information Resource (ESTIR)", which lists over 1,000 links to electrochemistry-related sites [7]...

Еще в разделе: (Показать все результаты (>33) - electr003.chem.msu.ru/ )

... Annex (e.g. 3.1) (3) Paragraph/ Figure/Table/ Note (e.g. Table 1) 4 Type of comment2 5 Comment (justification for change) by the MB Date: (6) Document: (7) Secretariat observations on each comment submitted Proposed change by the MB RU RU RU RU 2 2 2 2 Row 2 Row 4 Row 4 Row 5 ed ed ed te SEPs are not fluxes , but particles It is desirable to add that Wolf number is also known as the sunspot number. ... CLOSED: Accepted and implemented in modified form CLOSED: Accepted and RU 2 Row 16 . ...

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

• http://srd.sinp.msu.ru/nymmik/models/hilgers.pdf

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )