... Evolution 2.24 User Guide . ... Backing Up And Restoring Evolution . ... With the Backup and Restore plug-in enabled, you can successfully back up Evolution to your machine and restore it whenever it is required. The backup saves your Evolution gconf settings, mail, contacts, tasks, memos, and calendars and creates an archive. Select File > Backup Settings to select the folder where you want to save the backup. ... Select File > Restore Settings to open the available evolution.tar.gz files. ...

Еще в разделе: (Показать все результаты (>529) - uneex.lorien.cs.msu.su/ )

• Additional Options
• License agreement
• Importing Your Old Email

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... ELFIN-L . ... It consist of a Flux Gate Magnetometer (FGM), an Energetic Particle Detector for Electrons (EPDE), and an Energetic Proton Detector for Ions (EPDI). ... Energetic particles create a hazardous environment for satellites and humans in space and cause a number of satellite failures. ... Magnetospheric particles and radiation environment . ...

Еще в разделе: (Показать все результаты (>30) - lomonosov.sinp.msu.ru/ )

• DEPRON | Университетский спутник "Ломоносов"
• TUS | Университетский спутник "Ломоносов"

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>166) - www.pereplet.ru/ )

... In the domestic neuropsychological literature, these issues are need attention: standardized procedures for presenting stimuli are not, as a rule, described; basic psychometric assessment of the results of the tests is lacking; no investigation of their clinical and psychometric validity is carried out. ... First, it is necessary to develop adequate psychometric techniques that preserve the informative value of qualitative and quantitative diagnostic data, as well as their combinations. ...

Еще в разделе: (Показать все результаты (>179) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/science/psyrussia/2012/isaychev.pdf
• Psychology in Russia. Distribution

I have dropped the differentiation of HTML into a sequence of conformance levels. ... This (and upward compatible specifications) define the Internet Media Type (RFC 1590) and MIME Content Type (RFC 1521) called "text/html". The type "text/html" accepts the following parameters: . ... Character sets . The charset parameter (as defined in section 7.1.1 of RFC 1521) may be used with the text/html content type to specify the encoding used to represent the HTML document as a sequence of bytes. ...

Еще в разделе: (Показать все результаты (>182) - comet.sai.msu.ru/ )

• Interdisciplinatory Colloquium on cosmic factors of evolution of the biosphere
• Creating a distribution list
• Multiwavelength Study of Mira Ceti-Type Variable Stars

Chemical Physics 409 (2012) 61-73 Contents lists available at SciVerse ScienceDirect Chemical Physics journal h omepage: www.elsevi er.c om/locate/chemphys Orientation distribution function and order parameters of oriented spin probe as determined by EPR spectroscopy Andrey Kh. ... 4о Fig. ... Orientation distribution functions obtained by simulation of spectra in Fig. 10: (a) using OP approach (parameters in column 1 of Table 6); (b) using OD approach (parameters in column 3 of Table 6). ...

Еще в разделе: (Показать все результаты (>161) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/028e.pdf
• Program ODF3
• THE EFFECT OF CATALYST ON INTERMOLECULAR HETEROGENEITY DISTRIBUTION IN

... Fursikov Andrei Vladimirovich . Head of the Department . ... Navier-Stockes equations, statistical hydrodynamics, theory of control for systems with distributed parameters. student of Mark Iosifovich Vishik . ... He is a member of the editorial board of "Journal of Dynamical and Control Systems", "Journal of Mathematical Fluid Mechanics", "Interdisciplinary Math. ... 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . ...

Еще в разделе: (Показать все результаты (>97) - new.math.msu.su/ )

• Scientific directions | Department: General Problems of Control. Faculty of

... Graduate student, School of Public Administration, Lomonosov Moscow State University. ... An analysis of evolution of different theoretical approaches to public policy has shown that there was transition from consideration of actors of decision-making process as a cohesive group (elite) to revealing separate groups of influence (groups of interests), and then to specification of small formations (triangles, networks, coalitions), pursuing private interests and purposes. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>345) - ee-journal.spa.msu.ru/ )

... Statistical Irreversibility of the Kac Reversible Circular Mo del Valery V. Kozlov* V.A. Steklov Mathematical Institute Russian Academy of Sciences ul. Gubkina 8, Moscow, 119991 Russia Received Octob er 29, 2010; accepted Decemb er 4, 2010 Abstract--The Kac circular model is a discrete dynamical system which has the property of recurrence and reversibility. ... However, this p oint of view contradicts the initial prop erty of reversibility of the equations of motion for mechanical systems. ...

Еще в разделе: (Показать все результаты (>140) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/c96/169-the-vlasov-kinetic-equation-dynamics-of-continuum-and-turbulence_ru.pdf
• http://ics.org.ru/upload/iblock/0cd/RCD232.pdf
• http://ics.org.ru/upload/iblock/daa/139-notes-on-diffusion-in-collisionless-medium_ru.pdf

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>30) - mailybaev.imec.msu.ru/ )

• Book review by Professor Teodor M. Atanackovic

... A comparative study of thermodynamic for both natural and artificial RNA/DNA ­ protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA ­ protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...

Еще в разделе: (Показать все результаты (>8) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/nar2004.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

The purpose of the space-physics lab exercises is to introduce the students to the methods of the measurements, to the modern conception of near-Earth space structure and the physical processes and phenomena occured in it. ... At present the reasearches and the teachers of the University and of other institutes participating in the project continue development of the the special space-physics lab exercises, and they are interested in your ideas concerning the future exercises. ...

Еще в разделе: (Показать все результаты (>79) - cosmos.msu.ru/ )

• University Satellites and Space Science Education '2006 I

J/AstL/vol/page SAI Open Clusters Catalog (Glushkova+, 2009) ================================================================================ Automated search for star clusters in large multiband surveys. ... Color excesses E(B-V), distance moduli and ages were determined for 141 new and 27 known, but poorly studied clusters. We present the Sternberg Astronomical Institute Open Clusters Catalog (SAI OCL Catalog) of coordinates, diameters and main physical parameters of these clusters. ...

Еще в разделе: (Показать все результаты (>5) - ocl.sai.msu.ru/ )

• SAI Open Star Clusters (SAI OCL) Catalog
• SAI OCL Catalog Description
• SAI OCL Catalog Structure

PAL2NAL output ERROR: if "codon(Output format)" is selected, don't use "Remove gaps, inframe stop codons" or "Remove mismatches" or "Use only selected positions". Synonymous (KS) and non-synonymous (KA) substitution rates calcualted by codeml in the PAML package: KS = 2.2360 KA = 0.2265 KA/KS = 0.1013 You can see the parameters used in codeml to calculate these values. If you use these values, please cite the following peper: Goldman, N. and Yang, Z. 1994. ...

Еще в разделе: (Показать все результаты (>9629) - kodomo.fbb.msu.ru/ )

• allpy: 0192c5c09ce8
• allpy: log
• allpy: 1785e40b2a2d allpy/fileio.py

Mueller polarimetry as a tool for detecting asymmetry in diffraction grating profiles Tatiana Novikovaa) and Pavel Bulkin LPICM, CNRS, Ecole Polytechnique, Palaiseau 91128, France b) Vladimir Popov Skobeltsyn ... Ecole Polytechnique, Palaiseau 91128, France (Received 19 March 2011; accepted 19 July 2011; published 9 September 2011) Reflected Mueller matrix spectra were measured and simulated for asymmetrical photoresist master diffraction ... Parametric model of grating profile. ...

Еще в разделе: (Показать все результаты (>49) - genphys.phys.msu.su/ )

• http://genphys.phys.msu.su/rus/sci/photonics/PDF/2.pdf
• Index of /rus/edu/kvant/II_2/STAT2/_private/distribution.files
• Index of /rus/edu/kvant/II_2/STAT2/_private/distribution.files/_vti_cnf

... Advanced chapters of operation research . Algebraic characterization of basic solution of linear program. ... Advanced chapters of Actuarial Mathematics . ... Discounted cash flow analysis and capital budgeting as decision tools are given particular emphasis. ... In the first part of the course we present a modern approach to modeling economic systems. ... The problem of tax optimization under a given financing budget. ... Магистратура: master@cmc.msu.ru, 3-й этаж, комната 360, тел. ...

Еще в разделе: (Показать все результаты (>130) - hcs.cmc.msu.ru/ )

• Mathematical Models of Complex Systems: Theory, Algorithms, Applications |
• Mathematical models and methods in VLSI design | Магистерское и послевузовское

INTRODUCTION . The Network for Agricultural Policy Research and Development (NAP) is a voluntary organization initially established and promoted by the Agriculture and Economic Development Analysis Division of the Food and Agricultural Organization (FAO) of the UN in collaboration with Governmental and non-Governmental institutions in Central and Eastern Europe (CEE). ... While each country has embarked on economic reform with a different legacy, the main priorities are common to all countries. ...

Еще в разделе: (Показать все результаты (>195) - www.fadr.msu.ru/ )

• SCENARIOS FOR INTEGRATION
• PROCEEDINGS OF THE FORTH INTERNATIONAL SYMPOSIUM AND FIELD WORKSHOP ON
• NAP NEWSLETTER N. 1

... The nonlinearity has the form of a sigmoid function of two parameters a and b. The zoning of the plane (b; a) with respect to the number and type of stationary states (critical points) for the model under consideration is performed. ... The function g(u) (called a shot function) is expressed by g(u; a; b) = 1 1 + a exp(\Gammabu) (2) where the parameters a and b are positive. ... Analysis of critical points. ... The center­type stable critical points correspond to a minimum of the function U (u) [3]....

Еще в разделе: (Показать все результаты (>224) - num-anal.srcc.msu.ru/ )

• Сервер по Численному анализу
• Параллельные программы. ЛИТЕРАТУРА

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...