... Why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... Filters are used to remove low-complexity sequence because it can cause artifactual hits (please see Q: After running a search why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ...

Еще в разделе: (Показать все результаты (>191) - www.genebee.msu.ru/ )

• Основной заголовок
• Genebee Predicted Annotation
• GeneBee ClustalW 1.83

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>5) - www.rlcentre.com/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

... ОТЧЕТЫ СТУДЕНТОВ О ПРАКТИКЕ В САО . Лето 2001 года . ... Гришатовой Юлии . ... Для определения лучевых скоростей, FWHM (полной ширины на половине максимума) и интенсивности линия He I 6678.15А описывалась гауссианой ( рис.1 ). ... create/icat {P1} ztsh*.bdf . execute/catalog @@ set_lambda {P2} . execute/catalog @@ timing {P2} . execute/catalog @@ phase {P2} . ... create/table {P1}.tbl . ... create/column {P1}.tbl fwhm . execute/catalog @@ add_rv_curve_point {P2} {P1}.tbl . ...

Еще в разделе: (Показать все результаты (>13) - heritage.sai.msu.ru/ )

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

Еще в разделе: (Показать все результаты (>4) - saistud.sai.msu.ru/ )

... The Adhesive Mechanism of Hysteretic Nonlinearity for Media with Cracks . ... The creation of models of different defects (dislocations, cracks etc.) and construction of state equations for solids containing such defects, is one of modern problems of nonlinear acoustics and seismic-acoustics. ... This circumstance creates favorable capabilities for nonlinear acoustic diagnostics of both single defects in solids, and solids containing a great number of such defects. ...

Еще в разделе: (Показать все результаты (>133) - acs366.phys.msu.su/ )

• AUTHOR : Gavrilov L
• AUTHOR : Filonenko E

... Publications . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Lomonosov Moscow State University . ... Publication type . Conference paper . ... Publication date . ... Conference . 17-th International Conference on Computer Graphics GraphiCon'2007 . ... Moscow, Russia . ... BookTitle = {17-th International Conference on Computer Graphics GraphiCon'2007}, . ... Address = {Moscow, Russia}, . ...

Еще в разделе: (Показать все результаты (>105) - imaging.cmc.msu.ru/ )

• Basic edges | Laboratory of Mathematical Methods of Image Processing

... Shipping Icons . E-Commerce Icons . Building Icons . Hosting Icons . ... But to make your website or interface design a real eye-catcher there was one thing missing: Icons! Icons are an essential tool to simplify user interfaces and today almost every major website uses icons to highlight important parts in their content. ... Visit Website . ... escort beylikduzu bayan escort escort bayan escort escort istanbul escort bayan porno film escort istanbul escort beylikduzu escort bayan ...

Еще в разделе: (Показать все результаты (>5) - physcontrol.phys.msu.ru/ )

• List All Categories
• Widgetkit

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Departments . ... Field training . ... The department curriculum is focused on preparation of experts of the top skills in the field of tourist business, tourist service, the government in tourism sphere. ... A theme of scientific work of department Territorial touristic-recreational systems: natural and social and economic preconditions of a sustainable development includes three underthemes. ...

Еще в разделе: (Показать все результаты (>44) - eng.geogr.msu.ru/ )

• History

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>5) - psyberlink.flogiston.ru/ )

University Satellites and . Space Science Education . ... The purpose of the developed scientific - educational program complex is creation on the Earth on the base of telemetry data of virtual model of microgravitational environment in which experiments are carried out, and virtual motion model of of the space vehicle. ... The developed program complex concerns to the class of the distributed program systems. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>47) - cosmos.msu.ru/ )

Particle pair production in strong EM field, Imaginary temperature and field emission Boris Levchenko SINP MSU, Moscow Tunneling processes (Nature, adv. technologies) Electron field emission from metals: quantum theory by Fowler and Nordheim Results by Sauter and Schwinger for electric field in vacuum Condensed matter .vs. ... QFTHEP'10, BB Levchenko Pair production 16 Scheme of probing strong-field QED in the collisions of a 50-GeV electron beam with a focused laser beam. ...

Еще в разделе: (Показать все результаты (>118) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf
• http://qfthep.sinp.msu.ru/talks2013/POZDEEVAQFTHEP13.pdf

... Only by numerical simulation. ... moment T (K) Dipole moment (D) Experiment Other example: Diffusion constant 200 250 298 350 400 2.40 2.37 2.48 2.59 2.80 2.25 The Distribution functions: radial distribution function 1 g (r) = N t =1 j i N TS N pair ( r - rij ) The Distribution functions: radial distribution function CC def 2 Work mode ­ computer related 1) · Perform simulation , create trajectory file · Calculate properties timestep by timestep 2) · Perform ...

Еще в разделе: (Показать все результаты (>20) - www.elch.chem.msu.ru/ )

Given word length and max number of mismatches . Use MEME algorithm for define conserved blocks . Apply the Dynamic programming algorithm to create chain of the blocks . Refine the chain using combined profile for chain of blocks. ... Reduce word length and number of mismatches and repeat the procedure for spacer between the blocks. ... Create helix profile and apply MEME-like iterative procedure to find sets of helices that consistent lokated reative to conserved blocks . ...

Еще в разделе: (Показать все результаты (>137) - bioinf.fbb.msu.ru/ )

... Study of diaries and notebooks . The project is devoted to the research work of diary texts in Russian tradition and worldwide. The task of the work is to study, describe and create an independent corpus of computerized diary texts, i.e. diaries, note-books, autobiographies, memoirs, letters, which are called 'everyday literature' or 'ego-texts'. ... It is necessary to classify all types of Russian diary texts dating at least from the 17th century and up to now. ...

Еще в разделе: (Показать все результаты (>17) - lcl.srcc.msu.ru/ )

... While the faster process has characteristics corresponding to the conventional metastable dangling bond creation, the characteristics of the slow process are shown to be anomalous (the activation energy for defect creation higher than that for the normal process and the parameter beta decreasing with temperature). ... The model accounts for the observed features of the anomalous process. A possible underlying microscopic mechanism of structural changes is discussed. ...

Еще в разделе: (Показать все результаты (>63) - scon155.phys.msu.su/ )

• Influence of random fields on the ferroelectric phase transition in IV-VI

... The international conference " Differential Equations and Topology " devoted to the 100th Anniversary of the birthday of Lev Semenovich Pontryagin was held in Lomonosov Moscow State University, June 17-22, 2008. Head of the ASR Department RAS Corresponding Member Dmitry P. Kostomarov had a talk "Problems for Ultrahyperbolic Equations in Half-Space" [ PDF 413.47 KB ] on June 22nd at the subsection "Partial Differential Equations" of "Differential Equations" section. ...

Еще в разделе: (Показать все результаты (>16) - ani.cmc.msu.ru/ )

• English edition of the ASR Department website
• Alexander Pozdneev at the ASMS 2008 Conference
• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on

... The international conference " Differential Equations and Topology " devoted to the 100th Anniversary of the birthday of Lev Semenovich Pontryagin was held in Lomonosov Moscow State University, June 17-22, 2008. Head of the ASR Department RAS Corresponding Member Dmitry P. Kostomarov had a talk "Problems for Ultrahyperbolic Equations in Half-Space" [ PDF 413.47 KB ] on June 22nd at the subsection "Partial Differential Equations" of "Differential Equations" section. ...

Еще в разделе: (Показать все результаты (>7) - ani.cs.msu.su/ )

• English edition of the ASR Department website
• Alexander Pozdneev at the ASMS 2008 Conference
• Alexander Pozdneev at the SIAG/LA-SIMUMAT International Summer School on

... The given course consisting of lectures and seminars is aimed at teaching our students a whole range of measures, which allow quick and efficient faultfinding, functional testing, reliability testing of a device, find replacement for a faulty component at the modern technological level, fix a device, create a similar device even without the blueprints. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ...

Еще в разделе: (Показать все результаты (>19) - engineering.phys.msu.ru/ )

• Jumping Robot

... Kkimiya UDC 547.821 DATABASE COVERING THE SYNTHESES OF PYRIDINE S FROM ACYCLIC REAGENTS: THE ROLE OF NONSTANDAR D RETRIEVAL REQUESTS I N DEVELOPING THE STRATEGY OF COMPUTER SYNTHESIS E. V. Babaev and S. V. Tsitovskii Th e methodolog y o f constructin g a databas e covering th e synthese s o f pyridin e ring i n a standar d ChemBas e shel l i s discussed . ... Double lines in the diagrams correspond to the skeleton bonds of the reagents that pass into the skeleton of the pyridine cycle. ...

Еще в разделе: (Показать все результаты (>124) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/032e.pdf
• THE ALTERNATION RULE: AN OLD HEURISTIC PRINCIPLE OR A NEW CONSERVATION LAW