Title Authors Key words Methodological bases of personal qualities research of managers and personnel selection for the public service, security personnel, managers of industrial enterprises A.A. Oseev, A.A. Oseev personal qualities of effective leaders of the civil service, the security sector, industrial enterprises , verification of Weber 's types of social action in empirical models of ...

Еще в разделе: (Показать все результаты (>54) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2014/4/14.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2015/3/11.pdf

... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>17) - uhecr.sinp.msu.ru/ )

• Новости КЛПВЭ

V.S. Chernysh, A.A. Haidarov, V.S. Kulikauskas. ... V.C. Chernysh, W. Eckstein, A.A. Haidarov, V.S. Kulikauskas, V.A. Kurnaev, E.S. Mashkova, V.A. Molchanov. ... В.С. Куликаускас, Е.С. Машкова, В.А. Молчанов, А.А. Хайдаров, В.С. Черныш, В. Экштайн. ... Поверхность, 1999, ?4. ... V.C. Chernysh, W. Eckstein, A.A. Haidarov, V.S. Kulikauskas, E.S. Mashkova, V.A. Molchanov. ... V.S. Kulikauskas, E.S. Mashkova, V.A. Molchanov, A.A. Haidarov V.S. Chernysh and W. Eckstein. ... Поверхность. ...

Еще в разделе: (Показать все результаты (>16) - physelec.phys.msu.ru/ )

SKOBELTSYN INSTITUTE OF NUCLEAR PHYSICS (SINP) A.N. Ermakov, V.A. Khankin, Yu.A. Kubyshin, N.I Pakhomov, J.P. Rigla, V.I. Shvedunov DESIGN AND MAGNETIC MEASUREMENTS OF THE EXTRACTION MAGNET FOR 55 MeV RACE TRACK MICROTRON MSU-SINP Preprint No 2011-2/866 1 UDC 621.039 A.N. Ermakov, V.A. Khankin, Yu.A. Kubyshin, N.I Pakhomov, J.P. Rigla, V.I. Shvedunov E-mail addresses: shved@depni.sinp.msu.ru DESIGN AND MAGNETIC MEASUREMENTS OF THE EXTRACTION ... Magnetic screen system optimization.. ...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

... The luminescence time dependence for two types of core/shell QDs (CdSe/CdS and CdTe/CdSe ) were investigated and were compared with behavior of naked ones (CdSe). ... Three different types of QDs were used in this work: simple core CdSe QDs, core/shell CdSe/CdS QDs and type II core/shell CdTe/CdSe heterostructures in charge carrier division regime (Fig.1). ... So core/shell nanocrystals demonstrate intermediate behavior between CdSe core-type QDs and CdTe/CdSe core/shell heterostructures. ...

Еще в разделе: (Показать все результаты (>59) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and semiconductor materials |
• The Laboratory of chemistry and physics of sensor and
• Лаборатория химии и физики полупроводниковых и сенсорных материалов

Subdeletion structures as additional evidence for different analysis of synthetic and analytic comparatives in Russian In Russian there are two seemingly interchangeable comparative forms of adjectives: synthetic (the suffix -ee) and analytic (the word bolee). ... One more peculiar characteristic pertaining to synthetic rather than analytic comparatives in Russian is the inability of the former to appear in so-called subdeletion structures. ... Masa vyse Vani. i(analytic+GEN). ... Pancheva, Roumyana. ...

Еще в разделе: (Показать все результаты (>299) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/main/courses/discourse/cassell_1996.pdf
• http://www.philol.msu.ru/~otipl/SpeechGroup/publications/krivnova-2001-2004/krivnova_bogdanov_specom-2004.doc
• http://www.philol.msu.ru/~summer/images/stories/program/program_08_eng

... 3D magnetosphere . ... Data . ... Magnetosphere . ... Magnetic field at the selected point Module of the Magnetic field distribution along Sun-Earth line Noon-Midnight magnetosphere structure . ... Point coordinates, where magnetic field will be calculated: . ... Magnetic field at MD outer edge . ... Magnetic field at TC inner edge . ... Distance to external edge of MD . ... Distance to inner edge of MD . ... Magnetopause stand-off distance . ... Distance to inner edge of geotail current sheet . ...

Еще в разделе: (Показать все результаты (>5) - swx.sinp.msu.ru/ )

... Stanley Milgram SIX DEGREES OF SEPARATION OR SMALL WORLD PHENOMENON 1998, Small world networks Steven Strogatz Duncan Watts Laszlo Barabasi and Reka Albert 1999 In 1999 American physicits Barabasi and Albert have shown that distribution of nodes by the number of links in tke most real networks is described by power law and they called such networks as scale-free networks Reprinted from Linked: The New Science of Networks by Albert-Laszlo ... Human disease network. ... disease ­ , ). ...

Еще в разделе: (Показать все результаты (>4) - www.soc-phys.chem.msu.ru/ )

EFFECT OF pH AND VFA ON H YDROLYSIS OF ORGANIC SOLID W ASTE By Adrie Veeken,1 Sergey Kalyuzhnyi,2 Heijo Scharff,3 and Bert Hamelers4 ABSTRACT: The anaerobic hydrolysis rate of organic solid waste was studied at fixed volatile fatty acid (VFA) concentrations ranging from 3 to 30 g COD/ L and fixed pH values between 5 and 7. ... In this way, it was possible to distinguish between the inhibitory effects of pH, total VFA, and undissociated VFA on anaerobic hydrolysis. ... VFA control. ...

Еще в разделе: (Показать все результаты (>145) - www.enzyme.chem.msu.ru/ )

• http://www.enzyme.chem.msu.ru/ekbio/article/biod98-9.pdf
• Biosensor Research Group
• Группа Биосенсоров

... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...

Еще в разделе: (Показать все результаты (>2) - www.imec.msu.ru/ )

Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . Duration of training : 1 year . Supervisor of studies : A.M.Balagurov (professor, D.Sc., bala@nf.jinr.ru ) . ... In FLNP JINR there are unique opportunities for neutronography researches of nuclear and magnetic structure of crystals. ... Supervisor of studies: V.Yu.Pomjakushin (Ph. ... The near order and magnetic structure in amorphous magnetics. ...

Еще в разделе: (Показать все результаты (>24) - foroff.phys.msu.ru/ )

• Postdoctoral training of foreign scientists at Physical Department
• Postdoctoral training (Cosmic Rays and Physics of Space)

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>6977) - mouse.belozersky.msu.ru/ )

• NPG-explorer

... PHYSICAL INSTRUMENTS FOR ECOLOGY, MEDICINE, AND BIOLOGY Laser­Electron X-Ray Source for Medical Applications E. G. Bessonov, A. V. Vinogradov, and A. G. Tourianskii Lebedev Physical Institute, Russian Academy of Sciences, Leninskii pr. ... It includes two electron storage rings (E 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. ... Electrons can be injected into the storage rings singly or during several cycles through the injectors. ...

Еще в разделе: (Показать все результаты (>13) - miles.sinp.msu.ru/ )

• http://miles.sinp.msu.ru/files/LEXG_ICLIM_2004.pdf
• http://miles.sinp.msu.ru/files/Berlin06_Source.pdf

... Borisov A. V. , Karavaev Y. L. , Mamaev I. S. , Erdakova N. N. , Ivanova T. B. , Tarasov V. V. Experimental Investigation of the Motion of a Body with an Axisymmetric Base Sliding on a Rough Plane . ... Borisov A. V., Karavaev Y. L., Mamaev I. S., Erdakova N. N., Ivanova T. B., Tarasov V. V., On the dynamics of a body with an axisymmetric base sliding on a rough plane, Russian Journal of Nonlinear Dynamics, 2015, vol. 11, no. 3, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>115) - ics.org.ru/ )

... The kinetics of the ESR signal from P700 (ESR signal I) was recorded at different concentrations of exogenous ferredoxin, ,A kinetic model was developed for ferredoxin-dependent cyclic electron transport around photosystem I. A multiparticle model was built to directly describe electron transfer in multienzyme complexes and restricted diffusion of mobile carriers in individual compartments (stroma, lumen, intramembrane space) of the system. ... Ferredoxin Lumen Photosystem I Plastocyanin Fig. ...

Еще в разделе: (Показать все результаты (>37) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3347.pdf
• http://library.biophys.msu.ru/PDF/3329.pdf
• http://library.biophys.msu.ru/PDF/3340.pdf

Heat transfer intensification on surfaces with 'eddy generating' relief at supersonic velocity of incident flow . ... Temperature field on plates with 'eddy generating' relief (dimples and projections) М=3.1 . Local coefficients of heat transfer distribution on plates with 'eddy generating' relief (dimples and projections) and a smooth plate flown over by supersonic air stream M=3 . ... Temperature distribution during flowing of supersonic stream over a single dimple . ...

Еще в разделе: (Показать все результаты (>8) - termogaz.imec.msu.ru/ )

... Monitoring of relativistic electron fluxes in the near-Earth space. Development of the methods for studying of relativistic electrons of fluxes in the regions of precipitation. Studies of the fluxes and spectra of high-energy electrons of the outer radiation belt of the Earth. ... Studies of the fluxes and spectra of high-energy electrons in the low-latitudinal regions (at small L). ... Studies of VLF electromagnetic radiation generated during the main phase of the lightning discharge. ...

Еще в разделе: (Показать все результаты (>8) - vernov-relec.sinp.msu.ru/ )

Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... K -correction in choose filter.. ... Redshift . Colour choose colour.. Colour value . Calculator . ... calculate spectral energy distributions , K-corrections calculator , GALEX FUV NUV , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...

Еще в разделе: (Показать все результаты (>8) - kcor.sai.msu.ru/ )

• K-corrections calculator (version 2010)

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• Align tool for DNA-protein complexes

... Earlier still lies the remaining frontier, where the first stars, galaxies and massive black holes formed. ... Building on this general framework, and relying on the development of efficient new computational tools, the fragmentation properties of primordial gas inside such minihaloes were investigated with numerical simulations, leading to the result that the first stars, so-called population III, were predominantly very massive4,8 (see Box 1 for the terminology used here). ... Astrophys. ... III. ...

Еще в разделе: (Показать все результаты (>15) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/stathyd/2005%20Smyth%20et%20al.%2C%20Differential%20diffusion%20in%20breaking%20Kelvin-Helmholtz%20billows.pdf
• http://ocean.phys.msu.ru/courses/stathyd/2001%20Ferrari%20et%20al.%2C%20The%20temperature-salinity%20relationship%20of%20the%20mixed%20layer.pdf