Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>6) - compmech.math.msu.su/ )

... Inorganic Synthesis . ... The course consists of the general laws of chemistry (principles of chemical thermodynamics, kinetics, solution theory, theory of chemical bond, structure of molecules), chemistry of elements (structure and properties of simple substances and mains of inorganic compounds, relationships of properties changes on the base of Periodic Law), reactions and methods of quality analysis. ... SPECIAL COURSE: PHYSICAL AND CHEMICAL BASES OF SOLID STATE SYNTHESIS OF INORGANIC MATERIALS ...

Еще в разделе: (Показать все результаты (>94) - www.inorg.chem.msu.ru/ )

• Joint Semiconductors Surface Study group
• Group of Hydrothermal Synthesis :: Scientific Interests

... 12, 43 ­ 44 (2012) / DOI 10.1002/pamm.201210013 Cases of Complete Integrability in Transcendental Functions in Dynamics and Certain Invariant Indices Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., 1, 119899 Moscow, Russian Federation The results of this work appeared in the process of studying a certain problem on the rigid body motion in a medium with resistance, where we needed to deal with first integrals having nonstandard properties. ...

Еще в разделе: (Показать все результаты (>38) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-98-1.pdf
• http://shamolin2.imec.msu.ru/art-102.pdf
• http://shamolin2.imec.msu.ru/art-112.pdf

... Graduate/PhD students as well as young specialists (including Post- Doc researchers) in the following areas: Material Science Semiconductors , RF, Electrical, and Electronic Engineering , Software Developing , Optical Engineering , and Fundamental Science are kindly welcome to participate in the Competition Application requirements: College/Graduate/PhD students, young specialists ... Science | ... Science |design, equipment design, chemical analysis, automation | ... Medal | ...

Еще в разделе: (Показать все результаты (>138) - www.msu.ru/ )

• Research Priorities in Sciences and Humanities at Moscow State University
• Faculty of Global Processes
• Faculty of Soil Science

... High Brightness RTM . ... Fig.1a: 70-MeV pulsed race-track microtron . Many applications require compact, inexpensive and efficient source of electron beam in energy range 10-100 MeV. ... Beam is focused by accelerating structure, which acts as RF quadrupole singlet, quadrupole triplets (12) installed at the even orbits return path and by electromagnet quadrupole singlet (9) installed at common axis. ... Fig.1b: 70-MeV RTM Schematic . ... Energy gain: 4.8 MeV / orbit . Orbits: 14 . ...

Еще в разделе: (Показать все результаты (>3) - vserv.sinp.msu.ru/ )

... A comparative study of thermodynamic for both natural and artificial RNA/DNA ­ protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA ­ protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/nar2004.pdf

Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...

Еще в разделе: (Показать все результаты (>6) - statsoft.msu.ru/ )

• InCO General Information In English

... The Informativeness of Coherence Analysis in EEG Studies A. P. Kulaichev UDC 612.821.6 Translated from Zhurnal Vysshei Nervnoi Deyatel'nosti imeni I. P. Pavlova, Vol. ... KEY WORDS: coherence, spectral analysis, EEG non-stationarity, amplitude modulation. ... In particular, the two fundamental differences between EEG signals and most other physical signals are not considered: a) fundamental non-stationarity; b) amplitude modulation at all frequency ranges. ... Coherence in technical addenda. ...

Еще в разделе: (Показать все результаты (>17) - www.protein.bio.msu.ru/ )

• http://www.protein.bio.msu.ru/~akula/Kulaichev%20Addition.pdf

... Kinetics of optical tweezers (OT)-induced spontaneous aggregation and disaggregation of red blood cells (RBCs) were studied at the level of cell doublets to assess RBC interaction mechanics. ... 1 Introduction Red blood cell (RBC) aggregation is the reversible clumping of cells under low-shear forces or at stasis. ... 1.4 Fibrinogen-Induced Red Blood Cell Aggregation 1.3 Factors Affecting Red Blood Cell Aggregation The factors affecting aggregation of RBCs can generally be separated into two parts. ...

Еще в разделе: (Показать все результаты (>73) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/applphyslett_103_061112.pdf
• http://nanolab.phys.msu.ru/sites/default/files/prb82_193402_2010.pdf
• http://nanolab.phys.msu.ru/sites/default/files/physrevlett.108.123901.pdf

Prof. A.Nekipelov Moscow School of Economics , Moscow State University Lomonosov The Concepts of Economic Growth and Economic Development: Standard Macroeconomics and Pure Economics Approaches A Lecture Presented on January 31, 2011 at the International School f or Students Organized by IASSA and Department of Computational Mathematics and Cybernetics, MSU Lomonosov Economic Growth and Its Measurement by ... This distinction is applicable to the field of economic investigation. ...

Еще в разделе: (Показать все результаты (>19) - www.mse-msu.ru/ )

... Студенческая Астрономическая обсерватория ГАИШ . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... For those really interested in galaxies, extragalactic astronomy or the aspects of cosmology we study, we can always find an interesting problem to work on. ... To make your work in the Group most effective, it would be useful to study the following courses read by our group members as well as the members of other groups in our and other institures. ... Student information . ...

Еще в разделе: (Показать все результаты (>29) - www.sai.msu.ru/ )

• IMCCE-SAI: Natural Satellites Service. Parameters and constants

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• Align tool for DNA-protein complexes

... Кафедра нелинейных динамических систем . ... В понедельник, 11 апреля 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Автор: Фурсов Андрей Серафимович 09.04.2016 . В понедельник, 28 марта 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Сотрудники кафедры НДСиПУ, участвующие в 2016 г. в экзаменационной комиссии - Боресков А.В., Краев А.В., Бобылева О.Н., Гончаров О.И., Капалин И.В. Автор: Фурсов Андрей Серафимович 22.02.2016 . ...

Еще в разделе: (Показать все результаты (>4) - ndsipu.cmc.msu.ru/ )

... Geography of World Economy . ... Nature Management and Geoecology . ... Research laboratories . ... Geoecology of the Northern Territories . ... Research staff . ... Solomatin, V.I. (Geocryology, Geoecology), Professor, Doctor of Geography . ... Ogorodov, S.A. (Arctic Coastal Dynamics), Doctor of Geography . ... Fedorov, V.M. (Climate Dynamics, Ice Mass Balance), PhD . ... Dynamics of the Russian Arctic Coasts [Dinamika arkticheskix poberezhij Rossii] / Ed. by Solomatin V.I., Sovershaev V.A., 1998. ...

Еще в разделе: (Показать все результаты (>110) - eng.geogr.msu.ru/ )

• Recreational Geography and Tourism
• Complex Mapping
• THE MAKKAVEEV LABORATORY OF SOIL EROSION AND FLUVIAL PROCESSES

First Russian Conference "OZONE AND OTHER ENVIRONMENT FRIENDLY OXIDANTS. ... 7-9 June 2005, Moscow . ... State of Art and Perspectives of Ozone Application for Water Treatment in Russian Federation . ... The foreign as well as the native ozonizers are used at these stations. ... State Univ. ... The report on the impulse corona ozonizer (Russian Scientific Centre 'Kurchatov Institute', 'NTC ECOS', Moscow) with ozone synthesized from the undrained air was presented to the participants of the Workshop. ...

Еще в разделе: (Показать все результаты (>46) - www.kge.msu.ru/ )

• IVAKIN YURY DMITRIEVICH
• Theoretic Catalysis Group
• Proceedings of the 15th Ozone Congress

... The field of the fast first pulse is mainly localized within low refractive index layers, whereas the slow second pulse field is mostly in high refractive index layers. ... In the PC, each spectral component of a pulse incident at the Bragg angle with respect to the PC layers splits up into a coherent superposition of two transmitted and two diffracted diffractively reflected waves. ... The first pulse is formed by the waves E01 and Eh1, whereas the second one is formed by waves E02 and Eh2. ...

Еще в разделе: (Показать все результаты (>39) - genphys.phys.msu.su/ )

• http://genphys.phys.msu.su/rus/sci/optics/literature/15.pdf
• http://genphys.phys.msu.su/rus/sci/photonics/PDF/5.pdf
• http://genphys.phys.msu.su/rus/sci/photonics/PDF/4(en).pdf

Кафедра ТЕОРИИ ВЕРОЯТНОСТЕЙ БОЛЬШОЙ СЕМИНАР КАФЕДРЫ ТЕОРИИ ВЕРОЯТНОСТЕЙ (руководитель - член-корр. РАН, профессор А.Н. Ширяев) February 9 - An approach to calculating the variance of Pitman estimators Alexander Novikov (University of Technology, Sydney) Nino Kordzakhia (Macquarie University, Sydney) We provide an analytic formula for the variance of the Pitman estimator for a location parameter of independent observations and also some change- point estimators. ...

Еще в разделе: (Показать все результаты (>90) - new.math.msu.su/ )

• Department of Probability Theory
• Scientific fields of research of the Department of Theory of Plasticity
• Pobedria Boris Efimovich

... В качестве сравнительного материала определялся уровень стероидных гормонов в московской выборке (480 человек). ... Проведены две серии экспериментов для определения высотного соотношения между опорными поверхностями элементов рабочего места. ... Серии отличались высотой сиденья. ... Международный симпозиум, посвященный 150-летию парижского антропологического общества, 'От концепций из прошлого к исследованиям в будущем', 26-30 января 2009, Париж (А.П. Бужилова) (стр. ...

Еще в разделе: (Показать все результаты (>25) - www.anthropos.msu.ru/ )

ARTICLE IN PRESS N IM B Beam Interactions with Materials & Atoms Nuclear Instruments and Methods in Physics Research B xxx (2005) xxx­xxx www.elsevier.com/locate/nimb Gas cluster ion beam infusion processing of semiconductors R. MacCrimmon *, J. Hautala, M. Gwinn, S. Sherman Epion Corporation, 37 Manning Road, Billerica, MA 01821, United States Available online Abstract The application of gas cluster ion beam (GCIB) infusion in advanced IC fabrication is described. ... B xxx (2005) xxx­xxx Fig. ...

Еще в разделе: (Показать все результаты (>115) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/PhysRevA56_1997_2848NMKab.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb_sputteryield_sizeclasterion.pdf
• http://danp.sinp.msu.ru/LAS/Nimb212_03_96Teplova.pdf

Spinar Paradigm and Central Engine of the All Types Gamma Ray Bursts V.Lipunov1,2,3 & E.Gorbovskoy1,2,3 1Sternberg Astronomical Institute, Moscow, Universitetsky pr. ... A spinar is a quasi-equilibrium collapsing object whose equilibrium is maintained by the balance of centrifugal and gravitational forces and whose evolution is determined by its magnetic field. ... 10 Computed energy release during the process of collapse with low angular momentum and weak magnetic field. [pic] Fig .11. ...

Еще в разделе: (Показать все результаты (>29) - observ.pereplet.ru/ )

• http://observ.pereplet.ru/images/evgeny/article/2007/MNRAS.pdf
• MASTER GLOBAL ROBOTIC TELESCOPES NET