Poligraphic complex (printing plant) - humanitarian aid from RRU to South Ossetia A.A. Tibilov State University The printing plant is intended to make a wide range of materials - textbooks, manuals, presentations, reports, informational and commercial printed matters. ... wide color range, surpassing that of offset printing; . ... simple operation and high reliability. [pic] Besides the printer, there is a digital color copier Duplo DPS850 (Japan) size A3, in the printing complex. ...

Еще в разделе: (Показать все результаты (>31) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/327.doc
• http://www.rsr-online.ru/doc/norm/525.doc

... Геология >> Геотектоника | ... Добавить новое сообщение . ... Учебное пособие "Введение в тектонофизику". Гончаров М. А., Талицкий В. Г., Фролова Н. С. Ответ. ... Тезисы научной конференции ЛОМОНОСОВСКИЕ ЧТЕНИЯ, ноябрь 2011 года СЕКЦИЯ ГЕОЛОГИЯ: . ...

Еще в разделе: (Показать все результаты (>7) - phys.web.ru/ )

... Linguistic expeditions . ... Logical and stylistic aspects of lexical semantics . ... Linguistic phenomena can be approached and described from various perspectives. ... The approach proposed here is distinctive in that it is based on logic and stylistics, which are usually considered marginal to the description of linguistic phenomena. ... A special focus in the present approach on parallel texts is directly connected with translation . ...

Еще в разделе: (Показать все результаты (>15) - lcl.srcc.msu.ru/ )

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>51) - www.msm.biophys.msu.ru/ )

... In their previous pap ers, the authors of this study have suggested and realized a method of simultaneous determination of temp erature and salinity of seawater using laser Raman sp ectroscopy, with the help of neural networks. ... This pap er presents comparison of various input data compression methods using feature selection and feature extraction and their effect on the error of determination of temp erature and salinity. ... Walrafen, G.E.: Raman Sp ectral Studies of Water Structure. ...

Еще в разделе: (Показать все результаты (>25) - rswater.phys.msu.ru/ )

• http://rswater.phys.msu.ru/en/articles/2014/Kohonen.pdf
• http://rswater.phys.msu.ru/en/articles/2013/opt%20mem.pdf
• http://rswater.phys.msu.ru/en/articles/2014/Application.pdf

... Contact information . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty . ... Our goal is to provide researchers from many branches of science, education and industry with innovative tools and methods for solving applied problems using the latest information technologies, modern methods of computation modeling and scientific visualization. ... The uncertainty can be used in further uncertainty estimation of a computational model that uses FetchClimate. ...

Еще в разделе: (Показать все результаты (>112) - en.cs.msu.ru/ )

• Laboratory of Information Systems Security | CMC MSU
• Research Laboratory of Computational Modeling Tools
• Laboratory of Information Systems Security

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>12) - uneex.cs.msu.su/ )

• Uneex . SeminarRouting

... In vitro, the protein S7 of Thermus thermophilus is able to form complexes with both the minimal 16S rRNA fragment and the intercistronic region of the str operon mRNA from E.coli (Kd = 1.4x10-7 M and 1.1x10-7 M respectively). ... The filter binding assay. ... The most striking result of our study is that thermophilic protein S7 binds strongly to the E.coli S12-S7 intercistronic region of str mRNA in vitro, inspite of the lack of the functionally analogous thermophilic extended region. ...

Еще в разделе: (Показать все результаты (>5) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf

University Satellites and . Space Science Education . ... Scientific programme . ... About the remote cooperation in the field of space-physics education . ... During the last two years Skobeltsyn Institute of Nuclear Physics (SINP) of the Moscow State University and the Physics and Mathematics Faculty of Kostroma State University (KSU) develop a model of a space-physics educational process via Internet. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>38) - cosmos.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

... The Semantic Dictionary RUSLAN-1, the last version being Russian-to-English direction, is a tool for semantic and informational analysis of any coherent Russian text. The rich semantic information contained in the dictionary makes possible local, within one phrase, semantic interpretation as well as semantic analysis of coherent texts. ... Text understanding is very closely related to information analysis (Leontyeva 2000). ... We therefore call it "relative understanding". ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Semantic Resources for Textual Content Compression

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

134. Факультет фундаментальной медицины МГУ

135. SAI OCL Catalog The Team

136. Общемосковский семинар по электрохимии

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда