... Department . ... Prof. Dmitry P. Kostomarov at the Differential Equations and Topology Conference . ... Head of the ASR Department RAS Corresponding Member Dmitry P. Kostomarov had a talk "Problems for Ultrahyperbolic Equations in Half-Space" [ PDF 413.47 KB ] on June 22nd at the subsection "Partial Differential Equations" of "Differential Equations" section. ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>19) - ani.cmc.msu.ru/ )

• Department of the Automation for Scientific Research CMC MSU | Computational
• Courses | Department of the Automation for Scientific Research CMC MSU
• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the

. Please standby and you will be automatically connected to the new location of the unframed Supernova page. Or, click on the link above. If you have questions or problems, please email me at David Bishop dbishop@vhdl.org . Last modified: Mon Aug 27 12:40:15 EDT 2001

Еще в разделе: (Показать все результаты (>12) - www.rochesterastronomy.org/ )

... We discuss the calculation of the d.c. conductivity of granular metals on the insulating side of the metal--insulator transition. The granular structure is represented by a fractal percolation cluster and the problem of virtual tunneling-assisted conductivity is shown to be related to estimating the number of minimal paths for the problem of chemical distance metric on the fractal. ...

Еще в разделе: (Показать все результаты (>133) - scon155.phys.msu.su/ )

• Photoelectric phenomena and metastable states in amorphous semiconductors
• Theory of electronic properties of disordered semiconductors and systems with

DNS Security, Stability and Resiliency John Crain Chief Technical Officer April 21st 2009 Garmisch 1 Monday, 20 April 2009 Agenda · The Global DNS SSR Symposium · Problems and Opportunities · Questions? ... The level of awareness with respect to the DNS is very low" ­ All quotes from Symposium Report 7 Monday, 20 April 2009 Problems & Opportunities 8 Monday, 20 April 2009 Problem: · There is a need for training across all sectors of the industry to raise both skills and awareness. ...

Еще в разделе: (Показать все результаты (>12) - iisi.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

... Among them there is forward modeling for uniform anisotropic halfspace to calculate ARS diagrams for different arrays (AM (U), AMN (E), dipole equatorial (D), three-pole (T), Y and Arrow-type (AT) array, etc.), when source of current is on the earth surface or at a depth. All linear arrays (AM, AMN, dipole axial) give anisotropy ellipses with axis ratio equal to anisotropy coefficient, while non-linear arrays (D and others) have this ratio equal to anisotropy coefficient in the 5-th power. ...

Еще в разделе: (Показать все результаты (>82) - geophys.geol.msu.ru/ )

• Researchs
• Software for resistivity and induced polarization
• TRF_2d. Page 3.

Q: Recently I read a book called ?C14-CrashЃ by Christian Bloess and Hans-Ulrich Niemitz (there is a summary in German with figures on . ... Briefly, the authors claim that the majority of the original assumptions made by Libby for the radiocarbon . ... directly calculated from a C14 value." ... such fractions are used for calibrations and dating. ... used for radiocarbon calibration. ... important after atmosphere reservoir - upper ocean. ... radiocarbon content in the atmosphere. ...

Еще в разделе: (Показать все результаты (>112) - hbar.phys.msu.ru/ )

• Age Determinations by Radiocarbon Content: Checks with Samples of Known Age
• newtrev1.htm

... Massjuk N.P. Cyaneliae and taxonomic status of cyanomes. ... Minicheva G.G. Morphofunctional aspects of the diversity of the body form of algae. ... Rhodophyta ) under low illumination. ... Kovalenko O.V. New data on Cyanophyta of lakes of Shatsk Nature National Park (Ukrainian Polissya). ... Palamar Mordvintseva C.W. New for Ukraine Desmidiales ( Chlorophyta ) from the Carpathian Bilosphaere Reserve (Ukraine). ... Dogadina T.V. To the memory of Alexandra Miknailovna Matvienko (1910-1996). ...

Еще в разделе: (Показать все результаты (>209) - herba.msu.ru/ )

• Moscow State University, Geobotany dpt. - View Staff
• Moscow State University, Geobotany dpt. - Courses
• Moscow State University, Geobotany dpt. - View Courses

... Peer review | ... VIII International Conference 'Sorokin's reading'. Social inequality as a global problem of modernity' . Dobren'kov V.I. Foreword . ... Social inequality in modern Russia . Dobren'kov V.I., Dobren'kova E.V., Averin Y.P. Inequality of the Russian population in terms of quality of life and social preference order . ... Korkiya He.D. Social inequality in modern Russia: the cultural foundations . ... Kanevskiy P.S. International organizations in global social inequality . ...

Еще в разделе: (Показать все результаты (>65) - www.socio.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>299) - www.chemport.ru/ )

• тестеры определения насыпной плотности Pharma Test
• тестеры растворения твердых лекарственный форм Pharma Test
• Продукция ОАО 'ГалоПолимер' прошла испытания в Test America Laboratories -

Igor S. Dubenko . ... Magnetism in condensed matter, Physical properties of rare earth intermetallic compounds, magnetic and electrical properties of molecular clusters and compounds with giant magnetoresistance, magneto-electric effect, superconductivity. ... I.S. Dubenko , I.Yu. Gaidukova, E. Gratz, K. Inoue, A.S. Markosyan, V.E. Rodimin, Magnetic instability of the Co sublattice in the Ho 1? x Y x Co 3 system, Physica B 319 (2002) 21-27. ... Magn. 36 (2000) 3336-3338. ...

Еще в разделе: (Показать все результаты (>24) - ferro.phys.msu.ru/ )

• http://ferro.phys.msu.ru/lab6/eng/rodimin.htm
• http://ferro.phys.msu.ru/lab6/eng/markosyan.htm
• http://ferro.phys.msu.ru/lab6/eng/granovsky.htm

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>3) - www.rlcentre.com/ )

. 21.04.2014-23.04.2014 . Вход . Enter .

Еще в разделе: (Показать все результаты (>2) - sadovnichii75.mech.math.msu.su/ )

... Formulation of the problem ­ angle about the mass center C IC = mR 2 ­ central moment of inertia m and R ­ mass and radius of the hula-hoop k ­ coefficient of viscous friction r ­ radius of the waist FT ­ friction force N ­ reaction force ­ angle between x and CO x = a sin t , IC m m Ё +k (R - (R - y = b cos t = -FT R r ) = m (x sin + y cos ) + FT Ё Ё Ё r ) 2 = m (x cos - y sin ) + N Ё Ё (R - r ) = R ­ non-slippage where constants 0 mod 2 are defined from + µ cos 0 = 0. ...

Еще в разделе: (Показать все результаты (>12) - belyakov.imec.msu.ru/ )

• http://belyakov.imec.msu.ru/papers/PhysCon2005.pdf
• http://belyakov.imec.msu.ru/papers/Belyakov_Seyranian_6pages2011.pdf
• Anton O. Belyakov

. Posted by test 11 Sen 2006 19:12:31 . test . Attachment: test . Tratata Tratata 24/9/2006 ( 0) .

Еще в разделе: (Показать все результаты (>182) - www.fadr.msu.ru/ )

• IV International Conference on Cryopedology
• A LITTLE COMMENT to the Commentary about Soils, Paleosols and Geosols by Vance
• Created with DiDa

... General Psychology . Psychophysiology . ... Social Psychology . ... Psychological Principles of Personality Correction . ... Historical Psychology of Personality . ... Psychophysiology of Functional States . ... Social Psychophysiology . ... Psychological Influences on a Person in Clinical Psychology . ... Non-Russian Social Psychology in 20 th Century . ... Social Psychology of Personality . ... Process of Investigation in Social Psychology . ... Qualitative Analysis in Social Psychology . ...

Еще в разделе: (Показать все результаты (>203) - www.psy.msu.ru/ )

• Psychology in Russia: State of the Art, Vol. 2, 2009
• Faculty of Psychology at Lomonosov Moscow State University

... Medium (solvent) coordinates 3. Quantum effect of solvent on activation barrier 4. ... sucrose solutions: C D ( w) = + + 1 + (iw C ) 1 + iw water-EG mixtures: D 3 1 2 ( ) = + + + 1 + i 2 1 1 + i 2 2 1 + i 2 3 series N solvent modes Solvent reorganization energy (exact expansion ) correlation times K ( ) = 2k BT Solvent correlation function i =1 N i exp (- / ) * i i =1 N i = 1 i is the contribution of i-th mode to the solvent reorganization energy The solvent reorganization ...

Еще в разделе: (Показать все результаты (>19) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/malev.pdf
• http://www.elch.chem.msu.ru/mole/lecture/qantipov.pdf
• Laboratory of Electrical Double Layer and Electrode Kinetics

Execution performance of NAS tests . The tables, presented below, contain information about sizes and performance of MPI-programs and DVM-programs for NAS tests. ... Performances of DVM-programs and MPI-programs are comparable. ... Second, MPI-versions of some tests use parallelization along two dimensions of processor grid, whereas DVM-versions of all tests are performed now only on a line of processors. ... RCC-cluster Pentium III/500 + SCI, . ... BT test execution times in seconds (class A) . ...

Еще в разделе: (Показать все результаты (>110) - sp.cs.msu.ru/ )

• Development of portable program system
• Explicit cyclic schemes for space neutron kinetics in (Hex-Z) geometry
• DVM-system. Installation guide. Version 3.60

... Second set contains blast hits of the contig or the chromosome search against protein database, for example, Uniref90. ... Hit color corresponds to reading frame in the contig, color intensity is grteater than intensities of exons. ... Reading frame of five blast hits in the third exon of gene g4 are different than exon's reading frame . Blast hits in gene g3 located on reverse strand do not match reading frames of the 1st and 3rd exons and overlap 1-2 and 2-3 introns . ...

Еще в разделе: (Показать все результаты (>3) - mouse.belozersky.msu.ru/ )

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...