... Peer review | ... Dobren'kov V.I. Methodological and epistemological problems of formation of theoretical knowledge in sociology ( review ) Download PDF . ... Kormiletz A.S. A review of the three-volume edition of 'Soviet social policy 1920-1930's.: ideology and everyday life', 'Soviet social policy: scenes and characters', 'Social policy in modern Russia: reform and everyday life' ( review ) Download PDF . ... Obryvalina O.A. Problems of social control in the city ( review ) Download PDF . ...

Еще в разделе: (Показать все результаты (>66) - www.socio.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>25) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out

. .. : .. , . .. (Malsagovakh@gmail.com) , , , , history of Russian sociology, Positivism, Kareyev, Comte .. - , - () . In the article the author analyzes works of N.I. Kareyev (one of the first followers and popularizers of positivism in Russia, as well as a historian of Russian and world sociology) and the features of the refractive index of positivism (Comte) in the Russian social science and in creation of Kar eyev as its representative.

Еще в разделе: (Показать все результаты (>60) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2013/2/05.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/2/06.pdf
• http://www.socio.msu.ru/vestnik/archive/2014/1/13.pdf

Educational Technology & Society 10(3) 2007 ISSN 1436-4522 : .. . ... 1995). . ... Education Technology & Society 9(1) 2006 pp. 422-427. [ .., 1993] . ... Education Technology & Society 5(1) 2002, pp 222-243. ... Brusilovsky P., 1995] Brusilovsky P. Intelligent learning environments for programming: The case for integration and adaptation // In: J. Greer (ed.) Proceedings of AI-ED'95, 7th World Conference on Artificial Intelligence in Education, Washington, DC, 16-19 August 1995, AACE, pp. ...

Еще в разделе: (Показать все результаты (>154) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/science/psyrussia/2013/vartanova.pdf
• http://www.psy.msu.ru/science/psyrussia/2013-2/veraksa_pr_2013_2.pdf
• http://www.psy.msu.ru/people/nurkova/nurkova2004b.pdf

... Феноменология электрослабого рождения топ-кварков на адронных коллайдерах . ... Процессы с рождением топ-кварка. ... Основные результаты . ... Отбор событий . Критерии предварительного отбора . ... Применение метода нейронных сетей к экспериментальному поиску электрослабого рождения топ кварков на D? детекторе коллайдера Tevatron. ... Использование нейронной сети для удаления событий с космическими мюонами . Новые критерии начального отбора событий . ... Результаты применения нейронных сетей . ...

Еще в разделе: (Показать все результаты (>50) - top.sinp.msu.ru/ )

... Храм Кали в Дакшинешваре . ... Кали . ... Первое видение Кали . Опьяненный Богом . ... Брахмани . ... В союзе с Божественным Возлюбленным . ... Тотапури . Кали и Майя . Урок Тотапури . ... Эго" учителя . Обзор духовного опыта Учителя . Брахмо Самадж . Арья Самадж . ... Другие лидеры Брахмо . Стремление Учителя иметь своих учеников . Метод преподавания Учителя . ...

Еще в разделе: (Показать все результаты (>2) - pyotr.guru.ru/ )

... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...

Еще в разделе: (Показать все результаты (>63) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/STUDY/manual/ie2.doc
• http://geophys.geol.msu.ru/shevnin/publ/175.pdf
• http://geophys.geol.msu.ru/shevnin/publ/171.PDF

... PDF created with pdfFactory trial version www.pdffactory.com 2 . ... 2001. ... 1977. ... 1987. ... 1983, 1987. ... 1985. ...

Еще в разделе: (Показать все результаты (>24) - dynamo.geol.msu.ru/ )

• V.Zakharov's Ph.D. thesis
• Textbooks - Dynamic Processes in Geology

... Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. We have grown up in the laboratory of laser spectroscopy of water media. ... Use of such powerful modern tools of solution of inverse problems and problems of optimization provides successful solution of a wide range of applied problems of diagnostics and analysis of water media. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>27) - rswater.phys.msu.ru/ )

Site Navigation: . Site Contents . Наука . Резюме . Не наука . Программки . Карате . Книжки . Демки .

Еще в разделе: (Показать все результаты (>11) - optics.sinp.msu.ru/ )

... Our primary objective is the design and implementation of applied software tools for data processing, output and circulation of computer literature. ... Software tools for signal processing in medicine and engineering CONAN-m and CONAN-t. Statistical stable analysis tool for regression and factor models SIGN. ... Figurnov V.A. "IBM PC for Users" (in Russian). ... Boldin M.V., Simonova G.I., Tyurin Yu.N. "Sign Statistical Analysis of Linear Models" (in Russian and in English ). ... InCo . ...

Еще в разделе: (Показать все результаты (>2) - statsoft.msu.ru/ )

... News . For 1st and 2nd-year students . Introduction to quantum physics . ... About us . ... Create new account (active tab) . ... Request new password . E-mail * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Create new account . ... 2003 2016 Department of Quantum Electronics . ...

Еще в разделе: (Показать все результаты (>4) - quantum.phys.msu.ru/ )

• About us | Department of Quantum Electronics

Spes_innov_06_2007.qxd 10.07.2007 17:35 Page 1 Vivat academia! , . ... Moscow University / Moskauer Universitфt / Universitщ de Moscou / Universidad de Moscћ л Ё 2007 л Ё, лЁ 3D . ... лЁ , , Spes_innov_06_2007.qxd 10.07.2007 17:38 Page 3 Moscow University / Moskauer Universitфt / Universitщ de Moscou / Universidad de Moscћ л Ё 2007 3 Ё. , . ... Spes_innov_06_2007.qxd 10.07.2007 17:41 Page 6 6 Moscow University / Moskauer Universitфt / Universitщ de Moscou / Universidad de Moscћ л Ё 2007 л л Ё 2007 . ...

Еще в разделе: (Показать все результаты (>3) - inpro.msu.ru/ )

• Формирование инновационного образования в МГУ

Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

... Publications . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... D.V.Yurin . ... N. Mamaev , A. Lukin , D. Yurin . HeNLM-3D: A 3D Computer Tomography Image Denoising Algorithm // In: The 12th International Conference on Pattern Recognition and Information Processing . ... PDF . ... Vol. ... Ridge and tree feature detection on images // In: 11-th International Conference "Pattern Recognition and Image Analysis: New Information Technologies" , Vol. ...

Еще в разделе: (Показать все результаты (>256) - imaging.cmc.msu.ru/ )

... Herbal Antioxidants from the Journal of Orthomolecular Medicine . ... How the Antioxidants Complement Rather Than Compete with One Another . ... Interestingly, just as foods work together so do the antioxidants. ... Drink hot or warm, 1 to 2 cups per day, at bedtime and upon wakening. cheap longchamp bags . ... cheap michael kors uk . ... michael kors outlet uk . ... http://tamaratwhite.com/cheap-michael-kors-uk-how-to-properly-position-your-arm-when-swinging-a-golf-club/ . ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>103) - elana.sinp.msu.ru/ )

• Didn`t suggest we don?t adore determine producer creative designers. We
• cheap ray bans built by a network of over 50 | С Днем Победы!
• ralph lauren outlet uk Health Benefits of Soft Water | С Днем Победы!

... Geography of World Economy . ... Recreational Geography and International Tourism . ... World Data Systems functions under the sponsorship of the International Council for Science ICSU since 1956 (until 2008 in the form of two structures - World Data Centers and the Federation of Astronomical and Geophysical Data Analysis Services). ... Map "The population of the Russian Federation", scale 1:7 500 000, Russian Geographical Society, Faculty of Geography Moscow State University, OOO "FOC", 2014. ...

Еще в разделе: (Показать все результаты (>46) - eng.geogr.msu.ru/ )

• Vestnik MGU. Series 5. Geography
• Recreational Geography and Tourism
• Newsletter «RUSSIAN SUSTAINABILITY NewsLETTER»

... Custom Query . ... Component . ... automata io requirements ui . ... And љ Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . Or љ Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . ... Summary Component Milestone Status Owner Type Priority Resolution Created Modified Blocked By Blocking Reporter Keywords Cc . ...

Еще в разделе: (Показать все результаты (>693) - kodomo.cmm.msu.su/ )

• Custom Query в?' Cyclyc Cell Automata

... President George W. Bush Department of Education Strategic Goals: Goal One: Create a Culture of Achievement Create a culture of achievement by effectively implementing the president's plan, No Child Left Behind, and by basing all federal education programs on its principles: accountability, flexibility, expanded parental options, and doing what works. ... Goal Six: Establish Management Excellence Create a culture of accountability throughout the Department of Education. ... accountability | ... line...

Еще в разделе: (Показать все результаты (>3) - www.edst.msu.ru/ )

Кафедра Общей Физики и Волновых Процессов . физического факультета МГУ . Главная . ... О Кафедре . Наука и учеба . ... Публикации . Лаборатории . ... Наука . ... 18.03.2016 . Открыт прием заявок на участие студентов в Универсиаде "Ломоносов" . ... Главная Наука и учеба Публикации . ... 2009 Кафедра ОФиВП, физический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>80) - ofvp.phys.msu.ru/ )