Прогнозирование утечки радионуклидов из подземного могильника WIPP в биосферу, США. ... Представлен обзор результатов оценки возможной утечки в биосферу радионуклидов из подземного эксперим. могильника трансурановых РО ВПК США WIPP с учетом геологич. разрезов, обрушения и трещинообразования в коренной породе (соляной пласт) площадки могильника. ... Представленные результаты свидетельствуют о незначительности вклада нарушений коренной породы в расчетную оценку радиоактивной утечки из могильника. ...

Еще в разделе: (Показать все результаты (>19) - ecoinformatica.srcc.msu.ru/ )

... Reversibility of nucleoside diphosphate kinase solubilization from the surface of the outer mitochondrial membrane. ... It was found that in medium with low ionic strength nucleoside diphosphate kinase (NDPK) solubilization from the outer membrane of liver mitochondria could be partially reversed by the addition of 3.3 mM MgCl2. ... After solubilization of NDPK in the absence of leupeptin, cathepsins damage sites of its binding on the membranes. ...

Еще в разделе: (Показать все результаты (>81) - biochem.bio.msu.ru/ )

• Functional coupling between nucleoside diphosphate kinase of the outer
• Site-directed mutagenesis of cytochrome c: reactions with respiratory chain
• Structure and properties of chimeric small heat shock proteins containing

... The given course consisting of lectures and seminars is aimed at teaching our students a whole range of measures, which allow quick and efficient faultfinding, functional testing, reliability testing of a device, find replacement for a faulty component at the modern technological level, fix a device, create a similar device even without the blueprints. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ...

Еще в разделе: (Показать все результаты (>17) - engineering.phys.msu.ru/ )

• Parallel Programming
• Introduction to Linux

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ TSUNAMIGENIC POTENTIAL OF SUBMARINE EARTHQUAKES IN DIFFERENT REGIONS IN THE PACIFIC Viacheslav K. Gusiakov Institute of Computational Mathematics and Mathematical Geophysics, Siberian Division, Russian Academy of ... Fig. 1 shows the positions of 10 main tsunamigenic regions in the Pacific. ...

Еще в разделе: (Показать все результаты (>24) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E01_Armigliato.pdf
• http://seac47-2.phys.msu.ru/proc/E16_Nosov_Skachko.pdf
• http://seac47-2.phys.msu.ru/proc/E22_Watts.pdf

PHYSICS OF THE SOLID STATE VOLUME 41, NUMBER 8 AUGUST 1999 EXAFS studies of the local environment of lead and selenium atoms in PbTe1 solid solutions A. I. Lebedev, I. A. Sluchinskaya, and V. N. Demin M. V. Lomonosov Moscow State University, 119899 Moscow, Russia x Sex I. Munro Daresbury Laboratory, Warrington WA4 4AD, UK Submitted December 11, 1998; resubmitted January 20, 1999 Fiz. ... The Debye ­ Waller factor for Pb ­ Pb atom pairs as a function of the composition x of PbTe1 x Sex solid solutions. ...

Еще в разделе: (Показать все результаты (>82) - scon155.phys.msu.su/ )

• Ferroelectric phase transitions in IV-VI semiconductors associated with
• Physics of Semiconductors division: List of courses
• First-principles calculations of physical properties of crystals

... Two-dimension linear regression model. ... The econometric modeling of time series . ... The course aims to provide students with basic models and methods of econometric modeling of financial time series. ... The course considers in detail the major methods of econometric modeling of time series, in particular modeling by stochastic processes, modeling of stationary and non-stationary time series, the spectrum analysis of time series. ... The problem of tax optimization under a given state budget. ...

Еще в разделе: (Показать все результаты (>9) - io.cmc.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>16) - www.chemport.ru/ )

AFM OF RNA AND RNA-PROTEINS COMPLEXES . ... TMV RNA-MP complexes and RNA protruded from partly uncoated TMV particles can be visualized on freshly cleaved mica . Length distribution of denatured TMV RNA visualized on mica has 3 peaks: 0.7 microns, 1.4 microns and 2.0 microns . The structure of TMV RNA-MP complexes depends on RNA:MP molar ratio, which is in "beads-on-a-string" and "thick string" conformations at the MP:RNA molar ratio of 20:1 and 60:1 respectively. ...

Еще в разделе: (Показать все результаты (>85) - www.spm.genebee.msu.ru/ )

• Software Installation
• Working with files, containing Curves
• Averaging data

Diploma thesis abstract by Rumiantsev Yuri Temperature dependence of refraction index and absorption factor dynamics of azobenzene containing polymer layer This diploma paper work features temperature dependence of refraction index and absorption factor dynamics of azobenzene containing polymer layer. ... Basing on this model and experimental results the absorption cross-sections of trans and cis isomers and rotary diffusion factor of trans isomers have been calculated. ...

Еще в разделе: (Показать все результаты (>160) - ofvp.phys.msu.ru/ )

• Публикация
• Publication
• Laboratory of solid-state lasers and coherent spectroscopy

JOURNAL OF APPLIED PHYSICS VOLUME 96, NUMBER 1 1 JULY 2004 Theoretical analysis of the synergism in the dielectric strength for SF6 у CF4 mixtures A. V. Larin ґ Laboratoire de Physico-Chimie Informatique, Facultes Universitaires Notre-Dame de la Paix, Rue de Bruxelles 61, B ... Calculated electron energy distribution function EEDF for the SF6 /CF4 mixture solid lines and a pure CF4 dashed lines or b pure SF6 dotted lines vs the electron energy under the same E / N values as given in Table IV. ...

Еще в разделе: (Показать все результаты (>18) - beams.chem.msu.ru/ )

• http://beams.chem.msu.ru/sotrudniki/larin/IJQCh_04.pdf
• http://beams.chem.msu.ru/sotrudniki/larin/PCCP2.pdf
• http://beams.chem.msu.ru/doc/JCPSA613314144101_1.pdf

... A This result can be applied to a wide variety of data sets, including electricity bills1, street addresses, lengths of rivers, physical and mathematical constants, and processes described by power laws. ... Based on the plausible4 assumption that people who make up figures tend to distribute5 their digits fairly uniformly, a simple comparison of first-digit frequency distribution from the data with the expected distribution according to Benford's law had to show up any anomalous results. ...

Еще в разделе: (Показать все результаты (>21) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Academic_English_4.pdf
• http://www.eng.math.msu.su/download/dictionary.pdf
• http://www.eng.math.msu.su/download/Model_rendering.pdf

Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH­1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' ­ an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...

Еще в разделе: (Показать все результаты (>7) - top.sinp.msu.ru/ )

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) SN detection, V.Kulikovskiy, ANTARES meeting in Amsterdam 22-09-2010 1/14 SN progenitor stars distribution A half of the possible sources of SN type II explosion are at 10kpc. Sensitivity decreases as the square of the distance to SN SN detection, V.Kulikovskiy, ANTARES meeting in Amsterdam 22-09-2010 2/14 Methods overview Single rate 1. exclude OMs affected by bio bursts 2. ...

Еще в разделе: (Показать все результаты (>21) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%202.pdf
• http://antares.sinp.msu.ru/seminar/Kulikovskiy.pdf
• http://antares.sinp.msu.ru/docs/Shirokov%20-%20The%20first%20results%20of%20MSU%20groups%20in%20ANTARES%20project.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>17) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... By $A$ we denote the maximum of the moduli (of the absolute values) of the eigenvalues of this matrix . ... Self-similar solution . ... Адаптивный алгоритм . Adaptive algorithm . ... Additive set function . ... Algebraic random equation . ... Proximity analysis . ... Артикли . ... Multiplying the first relation in (1) by $x$ and the second one by $y$, followed by summation, we come to the concise form of the above equations . ... We try to find a solution to equation (1) which is of the form .. ...

Еще в разделе: (Показать все результаты (>303) - num-anal.srcc.msu.ru/ )

• http://num-anal.srcc.msu.su/eng_math/redict/15.htm
• http://num-anal.srcc.msu.su/eng_math/redict/16.htm
• http://num-anal.srcc.msu.su/list_wrk/ps1/ch2st2.ps

May 12, 1998 NOTES from May 9, 1998: The format of the Solar Event Lists was changed to include a standard SEC style header. ... Please send comments and suggestions to sec@sec.noaa.gov # # Missing data: //// # # Edited Events for 1998 May 11 # # Event Begin Max End Obs Q Type Loc/Frq Particulars Reg# #------------------------------------------------------------------------------- 2560 A0146 //// 1225 HOL ... The UT day of the event's begin time is the UT day of the list. ...

Еще в разделе: (Показать все результаты (>14) - dbserv.sinp.msu.ru/ )

• http://dbserv.sinp.msu.ru/RSWI/pics/chinasw.pdf

... A member of the Russian Academy ofsciences, a great physicochemist,and a world-renowned Professor Boris Vladimirovich Derjaguin died on May scientist, he laid the foundation of the modern science of colloids and surfaces. ... B. V. Derjaguin became known world-wide in scientific circles for his work on the stability of colloids and thin films of liquids which is now known as the DLVO theory, after the initials of its authors: Derjaguin, Landau, Verwey, and Overbeek. ...

Еще в разделе: (Показать все результаты (>32) - nanofluidics.phys.msu.ru/ )

• http://nanofluidics.phys.msu.ru/paper/vinogradova-lobaskin-2012.pdf
• http://nanofluidics.phys.msu.ru/paper/pf2007.pdf
• http://nanofluidics.phys.msu.ru/paper/jpcm2011.pdf