. English . Русский . Navigation . Home . About . News . People . Research . Publications . Teaching . Contacts . Wiki . Webmail . Webmail (archive) . Your name * . Your e-mail address * . To mikhalkov . Subject * . Message * . Search . Username * . Password * . Create new account . Request new password .

Еще в разделе: (Показать все результаты (>165) - nanolab.phys.msu.ru/ )

• Contact chetvertukhin | Laboratory of Nanophotonics & Metamaterials
• Contact musorin | Laboratory of Nanophotonics & Metamaterials
• Contact khokhlova | Laboratory of Nanophotonics & Metamaterials

.

Еще в разделе: (Показать все результаты (>235) - nuclphys.sinp.msu.ru/ )

• Fourth-year students of the Moscow Engineering Physics Institute
• Ядерная физика в интернете
• A.M.Baldin

... E-mail: Tchytannya@gmail.com Website of the Conference: www.tchytannya.org.ua Mailing address: National University "Law Academy of Ukraine named after Yaroslav Mudriy", Department of the Constitutional Law of Ukraine, organizing committee of The International Science Conference of Young Scientists, Researchers, Postgraduates and Students "Values of modern constitutionalism (V Todyka's readings)" Pushkinska street, 77, Kharkiv, 61024, Ukraine. ...

Еще в разделе: (Показать все результаты (>14) - www.law.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• StructAlign feedback

... Corresponding member of the Russian Academy of Education, Doctor in Psychology, professor, dean of the Psychology faculty, head of the Psychological methodology chair (M.V. Lomonosov Moscow State University). dek@psy.msu.ru . ... Corresponding member of the Russian Academy of Science, Doctor in Psychology, professor, head of the Communication psychology and psychosemantics laboratory (the Moscow State University of Psychology and Education). victor-petrenko@mail.ru . ... Editorial Board . ...

Еще в разделе: (Показать все результаты (>233) - www.psy.msu.ru/ )

• Moscow International Congress dedicated to the110th anniversary of Alexander
• Luria's continuing influence on international psychology
• Second Announcement

... Grants and contracts . ... Graphics Media lab is a leader in international cooperation among laboratories of Department of computational mathematics and cybernetics, Lomonosov Moscow State University. ... Grant RFBR 14-01-00849 "People detection, tracking and annotation in video streams". ... Contract ?Advanced video processing for various video applications?, ... Contract ?Energy efficient video transmission over wireless channel and advanced video processing for various video applications?, ...

Еще в разделе: (Показать все результаты (>806) - graphics.cs.msu.ru/ )

• Anton S. Konushin | Graphics and Media Lab
• Graphics and Media Lab | CMC department, Lomonosov Moscow State University
• Main | Graphics and Media Lab

contacts ]] . CompHEP . ... Members of CompHEP Collaboration: . SINP MSU, Moscow, Russia: E.Boos, V.Bunichev, M.Dubinin , L.Dudko, V.Edneral , V.ILyin, A.Kryukov , V.Savrin . ... Post address: CompHEP Collaboration Skobeltsyn Institute of Nuclear Physics Moscow State University 119991, Moscow RUSSIA Phone: +7(095)939-2875 Fax: +7(095)939-0397 E-mail: comphep@theory.sinp.msu.ru . Copyright (C) 2003-2006 CompHEP Collaboration Design by A.Kryukov . ... Contact us . ... CompHEP-3.3 Manual . ...

Еще в разделе: (Показать все результаты (>26) - comphep.sinp.msu.ru/ )

INTERNATIONAL CONFERENCE . February 26 - March 05, 2006, Moscow, Russia . ... Moscow State University . Institute of Mechanics of MSU . ... It follows the tradition of biannual confer-ences organized by the Institute of Mechanics of Moscow State University between 1976 and 2004 (see http://hit2003.narod.ru/ ), which were widely attended by scientists and students from the former Soviet Union. ... Phone, E-mail and Fax. ... Institute of Mechanics, Moscow State University . ...

Еще в разделе: (Показать все результаты (>37) - hit-conf.imec.msu.ru/ )

• Nonlinear Problems of Gydrodynamic Stability Theory
• Untitled

... My field of specialization is Stability Theory, Nonlinear Dynamics, Asymptotic Methods, Mechanics of Solids, System Identification, Optimal Control, Economic Growth. ... A.O. Belyakov and A.P. Seyranian (2012). ... A.O. Belyakov and A.P. Seyranian, . ... A.P. Seyranian and A.O. Belyakov, Swing dynamics. ... A.O. Belyakov, A.P. Seyranian, and A. Luongo, Regular and chaotic dynamics of the swing. 6th EUROMECH Nonlinear Dynamics Conference (ENOC 2008) , Saint Petersburg, Russia, June, 30 - July, 4 2008...

Еще в разделе: (Показать все результаты (>12) - belyakov.imec.msu.ru/ )

... Processes of regionalization in Post-Soviet space: contradictions of Russia-Belarus Integration. Moscow, Institute of economy RAS, 2010. ... Eurasian Economic Integration. ґ 2010, 1. 4. 10 years of EurAsEC: everything is just starting (in co-authorship with R. Grinberg)./ ... Scientific Reports of the Institute of Economics of RAS. ... Analytical Bulletin of the Centre for Problems of Globalization and Integration of Institute of economics of Russian Academy of Sciences", 2007, Issue 4 (12). ...

Еще в разделе: (Показать все результаты (>30) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/images/Intriligator_trnslt.pdf

... About CIE MSU . ... Student's Life . ... About Moscow University . ... Lomonosov Moscow State University . ... About Lomonosov Moscow State University . Lomonosov Moscow State University is the oldest and largest classic university in Russia. ... Every year over 40 thousand students study at the MSU, over 5 thousand are foreign students from 80 countries. ... Foreign students undergo training at the Center for International Education before entering the main faculties of the MSU. ... Students? ...

Еще в разделе: (Показать все результаты (>290) - www.cie.ru/ )

• Admissions :: CIE

... Инновационная . структура МГУ . ... Обучение инновационному менеджменту . ... Нормативно-правовая база инновационной . деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... Building on the objectives of your current business plan, you schedule a comprehensive series of promotional activities for your company. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>11) - innovation.msu.ru/ )

Institute of Mechanics , . Lomonosov Moscow State University , . ... Phone: +7 495 939 2039 . Fax: +7 495 939 0165 . E-mail: mailybaev imec.msu.ru . ... Mathematics . stability theory and dynamical systems . ... Physics and Mechanical Engineering . ... Engineering Faculty, University of l'Aquila, Italy . ... Department of Engineering Mechanics, Dalian University of Technology, China . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>33) - mailybaev.imec.msu.ru/ )

• Book review by Professor Teodor M. Atanackovic
• Curriculum Vitae of Dr Alexei A

... Univ. of Maryland . abdullin@mail.cern.ch . ... Dubna . korenkov@cv.jinr.ru . ... SINP MSU, Moscow . guardian@srd.sinp.msu.ru . ... PNPI RAS, Gatchina . ... ICP RAS, Moscow . ... baikov@theory.sinp.msu.ru . ... balaten@theory.sinp.msu.ru . ... JINR, Dubna . ... SINP MSU FSU, Tallahassee . ... Moscow St. Univ. serjik_b@newmail.ru . ... boos@theory.sinp.msu.ru . ... bunichev@theory.sinp.msu.ru . ... dolenko@srd.sinp.msu.ru . ... IIA RAS, S-Petersburg . ... Moscow St. Univ. andrey@cs.msu.su . ...

Еще в разделе: (Показать все результаты (>69) - acat02.sinp.msu.ru/ )

• ACAT'2002

.

Еще в разделе: (Показать все результаты (>21) - lab110.imec.msu.ru/ )

... Институт русского языка и культуры - учебное подразделение   МГУ имени М.В.Ломоносова , которое занимается преподаванием русского языка как иностранного и неродного, подготовкой иностранных граждан к обучению на профильных факультетах МГУ и в других высших учебных заведениях России, повышением квалификации и переподготовкой специалистов по профилю РКИ, тестированием, а также распространением и продвижением русского языка во всем мире. ... Институт русского языка и культуры МГУ имени М. В. Ломоносова...

137. INTERNATIONAL SYMPOSIUM

138. Студенческий форум Физфака МГУ > Новый журнал для быстрой публикации

139. 7th Conference of Biological Psychiatry "Stress and Behavior" -- Moscow, 2003.

140. Staff