... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...

Еще в разделе: (Показать все результаты (>9) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:39:14 Sat , 04 Dec 2010 20:28:47 GMT darkhan [20:eef739e055f4] * Automata.py ( modified ) Completed Automata: change_size, import from State, default states Sat , 04 Dec 2010 19:51:23 GMT Ilia [19:3d1a72f49417] * Interface.py ( modified ) little corrections Sat , 04 Dec 2010 19:42:50 GMT is_rusinov [18:d2705c3ee7a7] * ...

Еще в разделе: (Показать все результаты (>240) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=bb4a79cc6b6e424a24496b907ff54ff51d63e1c8&stop_rev=19%3A3d1a72f49417&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=bb4a79cc6b6e424a24496b907ff54ff51d63e1c8&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=23%3Ac74a9885bf04&limit=100&mode=stop_on_copy

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>4) - physcontrol.phys.msu.ru/ )

Analytical chemistry departmemt . Electrochemistry methods laboratory . ... GK 11.519.11.2041, Research and development of new systems using highly effective biosensors and electrochemical microscopy in colaboration with the Laboratory of Physical and Analytical Electrochemistry of the EPFL (Lausanne, Switzerland) 2012-2013 . ... GK 14.740.11.1374, Nano-analytical approaches for improving the efficiency of biosensors and development of the methods for a non-invasive clinical diagnosis, 2011-2013 . ...

Еще в разделе: (Показать все результаты (>26) - analyt.chem.msu.ru/ )

• Laboratory of Electrochemical Methods

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>72) - scon155.phys.msu.su/ )

... Russian grants: . The project of the Russian Foundation for Basic Research (RFBR), grant 00-02-16253 (2000 - 2002) . ... Nonlinear-optical effects in gyrotropic materials with photonic and electronic band structure: magnetic photonic crystals and magnetic nanostructures" . ... Program of Russian Ministry of Science "Physics of Solid State Nanostructures" Grant 1-036 . ... Professor Theo Rasing from Research Istitute for Materials, Catholic University of Nijmegen, Nijmegen, The Netherlands; . ...

Еще в разделе: (Показать все результаты (>26) - shg.phys.msu.ru/ )

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>16) - theorphys.phys.msu.ru/ )

... S.P.Kurdyumov Obtaining inexhaustible clean energy by parametric resonance under nonlocality clocking Simon Berkovich Department of Computer Science The George Washington University Washington, DC 20052 Abstract From time to time socio-economic progress calls for a drastic technological innovation. ... Our cellular automaton model of the Universe exposes underlying holographic mechanism yielding the sophistication of quantum mechanics and biological information processing. ... Fig. ...

Еще в разделе: (Показать все результаты (>460) - chronos.msu.ru/ )

• LOGIC OF CAUSAL MECHANICS: OBSERVATIONS-THEORY-EXPERIMENTS
• Laboratory-chair of causal mechanics
• THE PROBLEMS IN EXPERIMENTAL FOUNDATION OF CAUSAL MECHANICS

PIPELINES' STUDIES -- NEW PROBLEM FOR GEOPHYSICS. ... From the century's beginning many thousand kilometers of various pipes and cables were stacked in ground on depth up to 5-6 meters. ... On our opinion to these methods resistivity sounding (fig.2) and profiling, potential of cathodic protection study and pipe tracing with magnetic antenna should be added. ... At studies of horizontal magnetic field's component with the help of magnetic antenna, directed normally to a pipe axis, maximum Fig.3. ...

Еще в разделе: (Показать все результаты (>37) - geophys.geol.msu.ru/ )

... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>4) - biophys.msu.ru/ )

• C U R R I C U L U M V I T A E

Laboratory for Neurophysiology and Neuro-Computer Interfaces . ... Research of the Laboratory for Neurophysiology and Neuro-Computer Interfaces (NNCI) . The Human Brain Research Group (HBRG) was organized at the Department of Human and Animal Physiology , M.V.Lomonosov Moscow State University (Faculty of Biology) for carrying out basic scientific and applied projects in the area of studying human brain functional states underlying mental functions in normal and abnormal conditions. ...

Еще в разделе: (Показать все результаты (>46) - brain.bio.msu.ru/ )

• Alexander Kaplan * Александр Каплан
• BCI ALBUM | INTERESTING PEOPLE
• Sofia Tarasova

... The group led by Honorary Professor of Moscow State University, Laureate of the U.S.S.R. State Prize, A.D. Vinogradov, was organized in 1960s when Bioenergetics became a rapidly growing and expanding area of Biochemistry. ... In 1980, he was invited to New York State University as a visiting professor. ... According to the University official rating site, Prof. A.D. Vinogradov and Dr V.G. Grivennikova are on the list of the most frequently sited authors at the Moscow State University. ...

Еще в разделе: (Показать все результаты (>45) - biochem.bio.msu.ru/ )

• Reversibility of nucleoside diphosphate kinase solubilization from the surface
• Synergetic inhibition of the brain mitochondrial NADH:ubiquinone oxidoreductase
• Energy-linked binding of Pi is required for continuous steady-state

Международная культурная и научная конференция по механике для студентов, аспирантов и научных руководителей . ... Стамбул 9-16 мая 2009 г . ICAMES 2009 . ... CULTURAL and ACADEMIC MEETING . of ENGINEERING STUDENTS . ... ICAMES (International Cultural and Academic Meeting of Engineering Students) is an international, academic, scientific and cultural project competition that is held in May annually by the Engineering Society (ENSO) of Bogazici University. ... ICAMES 2009 (9 - 16 May 2009) . ...

Еще в разделе: (Показать все результаты (>31) - new.math.msu.su/ )

Summary Progress Report 2010 ­ 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...

Еще в разделе: (Показать все результаты (>80) - fgp.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf
• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-2.pdf
• http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>6) - iconolat13.phys.msu.ru/ )

• Guidelines

. SquirrelMail version 1.4.22-2.fc14 . By the SquirrelMail Project Team . ERROR . Your session has expired, but will be resumed after logging in again. Go to the login page

Еще в разделе: (Показать все результаты (>2) - mail.math.msu.su/ )

• MechMath - Login

... Предыдущее сообщение: PARALLEL.RU - Новости, специальный выпуск [16/11/2010] . ... Выпуск 298 . 23 ноября 2010 г. ------------- 1 декабря 2010 заканчивается срок представления аннотаций докладов на Международную научную конференцию Параллельные вычислительные технологии (ПаВТ) 2011 . http ://agora.guru.ru/pavt ------------- На странице Научного семинара PARALLEL.RU выложены ссылки на видеозапись выступления Томаса Стерлинга в НИВЦ МГУ имени М.В.Ломоносова 1 ноября 2010 года ...

Еще в разделе: (Показать все результаты (>89) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #389 [21/07/2015]
• PARALLEL.RU - Новости, выпуск #333 [02/10/2012]
• PARALLEL.RU - Новости, выпуск #269 [11/08/2009]

HumLang . HUMAN LANGUAGE . A list . ... This list is a part of Russian network “Social Sciences and Humanities” established and technically and financially supported by some Russian and American institutions. ... We’ll do our best to widen the flow of information about the state of the art in Russian linguistics, to inform subscribers and all those who simply is interested in our HumLang List on new linguistic (and related) works, conferences, updated bibliographies, sites, resources. ...

Еще в разделе: (Показать все результаты (>38) - old.philol.msu.ru/ )

• MSU-LGCLL:: DicTUM-1 - A System for Dictionary-Text Universal Manipulations and

The Future of GPU Computing Wen-mei Hwu University of Illinois, Urbana-Champaign Agenda · · · · Setting the Context Current Victories Coming Battles Conclusion and Outlook NVIDIA HPC Day Moscow State University 2012 CPUs: Latency Oriented Design · Large caches ­ Convert long latency memory accesses to short latency cache accesses ALU Control ALU ALU · Sophisticated control ­ Branch prediction for reduced branch latency ... NVIDIA HPC Day Moscow State University 2012 ...

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

• About the CCOE at Lomonosov Moscow State University | CUDA Center of Excellence