... QUANTUM INFORMATION AND COMPUTATION Absolute Robustness of the First Principal Fourier State Component and Noise Suppression in Hilbert Space Yu. ... 2, Moscow, 119992 Russia e-mail: skulik@qopt.phys.msu.su Received March 28, 2006 Abstract--The effect of the absolute robustness of the first principal Fourier-state component is developed upon rounding off the density matrix elements. ... This is interpreted as the absolute robustness of the first principal component of the Fourier state density...

Еще в разделе: (Показать все результаты (>73) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/kulik/Papers/nondeg_Bell.pdf
• http://qi.phys.msu.ru/kulik/Papers/p3214_1.pdf
• http://qi.phys.msu.su/papers/2007-os(e)-103-107.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

... -department of Environmental Technology, Wageningen University, PO Box 8129, 6700 EV Wageningen, The Netherlands Keywords Mathematical model ф Upflow anaerobic sludge bed reactor ф Dispersion ф Plug flow ф Sedimentation Nomenclature Coefficients in empirical equations A AC Ash content of the dry sludge aggregates (%) b Bacterial (death+lysis) rate coefficient ( dayю1 ) COD Chemical oxygen demand (g) CS ... Narnoli SK, Mehrotra I (1997) Sludge blanket of UASB reactor: mathematical...

Еще в разделе: (Показать все результаты (>138) - www.enzyme.chem.msu.ru/ )

• http://www.enzyme.chem.msu.ru/ryabov/pdf/O_97.pdf
• http://www.enzyme.chem.msu.ru/ekbio/article/dpfl_model.pdf
• http://www.enzyme.chem.msu.ru/ryabov/pdf/JBIC_99.pdf

Tools for monitoring of data exchange in real-time avionics systems V.V. Balashov, V.A. Balakhanov, A.G. Bakhmurov, M.V. Chistolinov, P.E. Shestov, R.L. Smeliansky, N.V. Youshchenko Lomonosov Moscow State University, Dept. of Computational Mathematics and Cybernetics, Laboratory of Computer Systems e-mail: {hbd,baldis,bahmurov,mike,osmin,smel,yoush}@lvk.cs.msu.su Abstract In this paper we present a toolset for monitoring of data exchange through onboard channels of real-time avionics (RTA) systems. ...

Еще в разделе: (Показать все результаты (>3) - lvk.cs.msu.su/ )

Theoretical and Mathematical Physics, 130(1): 123­135 (2002) FIELD THEORY ANALYSIS OF CRITICAL BEHAVIOR OF A SYMMETRIC BINARY FLUID N. V. Brilliantov,1 A. Yu. Loskutov,1 and V. V. Malinin 1 A method is elab orated for constructing an effective field theory Hamiltonian of the Landau­Ginzburg­ Wilson typ e for off-lattice models of binary fluids. ... In this paper, the critical behavior of a symmetric binary fluid is investigated by constructing an effective field theory Hamiltonian of the LGW type. ...

Еще в разделе: (Показать все результаты (>67) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/IJBC2004.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/JPA_DLA_2007.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/JETP10_05_Post_Los.pdf

. This document is designed to be viewed using the frames feature. If you see this message, you are using a non-frame-capable web client. Link to Non-frame version.

Еще в разделе: (Показать все результаты (>17) - angel.cs.msu.su/ )

... IBM? SPSS? ... 20 User?s Guide (PDF) . ... полезные ссылки фото IRT психометрика тестирование юзабилити мотивация исследования статьи выбор профессии big data психодиагностика статистика эмоциональный интеллект hr корреляция поиск скачать SPSS организационная психология презентация юмор анализ и визуализация данных профессии тесты видео ссылки эксперименты апробация теста онлайн-сервисы dropbox геолокация психологические журналы книги психологическое тестирование AMOS виртуальные ...

Еще в разделе: (Показать все результаты (>7) - tukachev.flogiston.ru/ )

• Tag: КФА

... Five Key Advantages of Online Banking . ... Most online banking systems feature this capability, allowing for you to enter in your account information for your billers, to pay them directly from your bank account. ... However, you may have the funds needed in another account such as a savings account. One of the advantages of online banking is the ability to transfer funds from one of your accounts to another. ... The advantages of online banking are increasing every year. ...

Еще в разделе: (Показать все результаты (>74) - elana.sinp.msu.ru/ )

• cheap north face How to Spot Counterfeit Tommy Hilfiger | С Днем Победы!
• longchamp outl | С Днем Победы!
• the bathroom has some of the most challenging areas to clean considering the

. # . Home . Services . Interaction . Calculate Hydrogen bond, Water bridges and Hydrophobic interaction for . Home Browse Download Help About Us . List of complexes . Pfam families . SCOP families . Interaction classes . Interaction modes . GO terms . ERROR! File was not found. NPIDB team 2003 - 2016 . text .

Еще в разделе: (Показать все результаты (>16) - npidb.belozersky.msu.ru/ )

• NPIDB: Home

... Keywords: anthropology, craniotrigonometry, skull angular morphometry, the Russian Imperial Romanov family, shaping angles parameters Sviridov A.A. Cranial study of population of Loyalty Islands (Melanesia) (p. 88) The aim of this work is to study cranial series of 67 skulls from the Loyalty Islands (Northern Melanesia), stored at Musee de l'Homme (Paris, France). ... The study of intragroup variability showed a difference in the cranial types of the population of the Lifou and Mare islands. ...

Еще в разделе: (Показать все результаты (>24) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2015_3.doc
• http://www.antropos.msu.ru/vestnic/e2015_1.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

Особенности загрязнения земель предприятиями нефтегазодобывающего комплекса Нижневартовского района . Features of land pollution by enterprises of oil-and-gas production complex in Nizhnevartovsk region. Ходжаева Г.К. // Нефтегазовое дело, 2011. ... В данной статье приводится зонирование территории Нижневартовского региона по площади и объему нефтяного загрязнения после аварий. URL: http://www.ogbus.ru/authors/Khodzhaeva/Khodzhaeva_1.pdf . ...

Еще в разделе: (Показать все результаты (>15) - ecoinformatica.srcc.msu.ru/ )

The Association for the Study of Nationalities (ASN) has recently launched its new webpage at www.nationalities.org . ... the association and its activities . ... membership rates and privileges (including an online membership form) . ... COMING THIS FALL: Call for papers for the 2002 ASN Annual Convention . ... The Association for the Study of Nationalities (ASN) is the only scholarly association devoted to the study of ethnicity and nationalism from Europe to Eurasia. ...

Еще в разделе: (Показать все результаты (>87) - www.prof.msu.ru/ )

• Swedish Professorship Awards
• INTERNET AND DEMOCRACY
• Косово и Чечня: сходство и различия

Welcome to K -corrections calculator, simple service allowing one to determine K -corrections of a galaxy, given its redshift and one or more colours. ... K -correction in choose filter.. ... Redshift . Colour choose colour.. Colour value . Calculator . ... calculate spectral energy distributions , K-corrections calculator , GALEX FUV NUV , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...

Еще в разделе: (Показать все результаты (>8) - kcor.sai.msu.ru/ )

• K-corrections calculator (version 2010)

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Source URL: http://ani.cs.msu.su/en/node . ... 8] http://ani.cmc.msu.ru/files/Расписание лекций консультаций 2015 (2).xls . ... 12] http://ani.cmc.msu.ru/files/Защ.дипл.работ 2015 (бПМиИ).doc . 13] http://ani.cmc.msu.ru/files/Защ.дипл.работ 2015 (спец.).doc . 14] http://ani.cmc.msu.ru/files/Гос.экз. 2015 (бПМиИ).doc . 15] http://ani.cmc.msu.ru/files/Гос.экз. 2015 (спец.).doc . ...

Еще в разделе: (Показать все результаты (>5) - ani.cs.msu.su/ )

... Deputy deans . ... Alexey Andreev БЂ“ Deputy Dean of the General Affairs and Strategic Development of the Faculty of Global Studies MSU, Associate Professor . ... School of Young Specialist at International Relations and preparatory courses of the Faculty of Global Studies are running. п п°п±пѕя‚п°пµя‚ я€пєпѕп»п° яЋпЅпѕпЕпѕ пјпµп¶пґяѓпЅп°яЂпѕпґпЅпёпєп° пё пїпѕпґпЕпѕя‚пѕпІпёя‚пµп»яЊпЅя‹пµ пєяѓяЂяЃя‹ я„п°пєяѓп»яЊя‚пµя‚п° пЕп»пѕп±п°п»яЊпЅя‹я… пїяЂпѕя†пµяЃяЃпѕпІ пјпЕяѓ . ... Home featured post (Page 46)...

Еще в разделе: (Показать все результаты (>176) - fgp.msu.ru/ )

Rates of thermal equilibration at the onset of subduction deduced from diffusion modeling of eclogitic garnets, Yukon-Tanana terrane, Canada Alexei Perchuk IGEM, Russian Academy of Sciences ... -Tanana terrane, Canada) underwent a prograde evolution from ~510 °C and 1.1 GPa to 690 °C and 1.5 Gpa followed by nearisobaric cooling to ~540 °C. A remarkable feature of the garnet porphyroblast cores is the presence of minute garnet ... Garnet is surrounded by haloes of phengite and minor chlorite. ...

Еще в разделе: (Показать все результаты (>64) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/petro/Perchuk_publ/perchuk_UniBull2011_CO2.pdf
• http://www.geol.msu.ru/deps/petro/Perchuk_publ/MorgunovaPerchuk.pdf
• http://www.geol.msu.ru/deps/geochems/soft/Guide_34.txt

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Nanocrystalline materials based on metal oxides for the detection of toxic and hazardous gases in the air. ... sensorovEst material group hopes that the new materials developed at the Faculty of Chemical laboratory "Chemistry and physics of semiconductor and sensor materials " will substantially increase the artificial olfaction. ... Acetone Sensing by Modified SnO 2 Nanocrystalline Sensor Materials. ...

Еще в разделе: (Показать все результаты (>36) - www.lssm.inorg.chem.msu.ru/ )

• Лаборатория химии и физики полупроводниковых и сенсорных

... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...

Еще в разделе: (Показать все результаты (>4) - np-chair.sinp.msu.ru/ )

... Authors: Nikku Madhusudhan et al. arxiv:1012.1218 Наблюдения рентгеновского пульсара MAXI J1409-619 на BeppoSAX в спокойном состоянии: открытие циклотронных линий (BeppoSAX observations of the X-ray pulsar MAXI J1409-619 in low state: discovery of cyclotron resonance features) . ... Authors: Christoph Mordasini et al. миниобзор arxiv:1012.2932 Магнитное поле нашей Галактики (The Magnetic Field of the Milky Way Galaxy) . Authors: Jo-Anne Brown . ... Authors: William E. Harris ...

Еще в разделе: (Показать все результаты (>133) - astro.uni-altai.ru/ )

• http://xray.sai.msu.ru/~polar/sci_rev/1308.html
• http://xray.sai.msu.ru/~polar/sci_rev/0402.html

2011 год . ... 2010 год . ... Известия РАН, Серия физическая, 2010, т. 74, ?10, с. 1441-1443. С.А.Вызулин, Е.В. Лебедева, Д.А. Лысак, Н.Е.Сырьев. ... Известия РАН, Серия физическая, 2010, т. 74, ?10, с. 1767-1769. ... Известия РАН, Серия физическая, 2010, т. 74, ?10, с. 1721-1723. ... 2009 год . ... В.Е. Буравцова, Е.А. Ганьшина, А.А. Дмитриев, О.С. Иванова, Ю.Е. Калинин, А.В. Ситников Известия Академии Наук, серия физическая, Т73, ?9, с. 1374-1376 (2009). _______________________________ . ...

Еще в разделе: (Показать все результаты (>30) - genphys.phys.msu.su/ )