... Data . ... Models . ... The International Geomagnetic Reference Field (IGRF) model is an empirical representation of the Earth's magnetic field recommended for scientific use by a special Working Group of the International Association of Geomagnetism and Aeronomy (IAGA). The IGRF model represents the core field without external sources. ... The NSSDC version uses the subroutines FELDG (magnetic field vector) and SHELLG (L shell) developed by G. Kluge at the European Space Operations Center (ESOC). ...

Еще в разделе: (Показать все результаты (>22) - smdc.sinp.msu.ru/ )

• Space monitoring data center
• AP8/AE8 model - Space monitoring data center
• APEV service - Space monitoring data center

Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...

Еще в разделе: (Показать все результаты (>5) - swx.sinp.msu.ru/ )

• SWX - Прогноз Dst

... Common information . ... no information] . ... since 1900-01-01 till today . ... Elsevier Science . ... http://www.sciencedirect.com/science/.. ... 1982-01-01 . 2001-12-31 . ... full-text . http://www.sciencedirect.com/science/... 1995-01-01 . today . ... http://elibrary.ru/issues.asp?id=96 . ...

Еще в разделе: (Показать все результаты (>229) - journals.genebee.msu.ru/ )

• Start JCatalog page

... Variations in soil acidity and in biodiversity were analysed in the National Natural Park "Russian North", European Russia. Improving soil quality from podzol, podzolic soil, derno-podzolic soil, brown earth to pararendzina leads to increase in diversity and changes in floristical composition, followed by changing of pine and spruce forest to mixed and birch forests. ... Our study shows that plants notably respond to soil acidification in boreal forest ecosystems. back . ...

Еще в разделе: (Показать все результаты (>30) - eco.soil.msu.ru/ )

• ASSESSMENT OF SOIL SUSTAINABILITY TO ACID DEPOSITION
• Forest ecosystem data in Norwegian-Russian border area
• Acid Deposition and Forest Soils. Eds. V.Nikonov G.Koptsik

ISSN 0026-2617, Microbiology, 2008, Vol. ... Key words: late stationary phase, secondary growth, Pseudomonas aeruginosa, S and M dissociants, population structure of the culture. ... Growth dynamics and population composition of a mixed culture of P. aeruginosa S and M dissociants in the variant of autolysis in the late stationary phase: optical density, OD з 100 (1); ratio of the M dissociant in the population, % (2); pH (3); and content of reducing sugars, mg % (as glucose) (4). ...

Еще в разделе: (Показать все результаты (>12) - dis.bio.msu.ru/ )

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Departments . ... Field training . ... The department curriculum is focused on preparation of experts of the top skills in the field of tourist business, tourist service, the government in tourism sphere. ... A theme of scientific work of department Territorial touristic-recreational systems: natural and social and economic preconditions of a sustainable development includes three underthemes. ...

Еще в разделе: (Показать все результаты (>54) - eng.geogr.msu.ru/ )

• Department of Oceanology

... These approaches were: (1) laser photobleaching of a path through the centrosome; (2) direct observation of microtubules in centrosome-containing cytoplasts; (3) GFP-CLIP-170 expression as a marker for microtubule plus end growth; and (iv) sequential subtraction analysis. ... This result signifies that most MTs persistently grow from their time of birth at the centrosome until their plus end nears the cell margin. ... Growth of nascent MTs in CHO cells was not only persistent but rapid. ...

Еще в разделе: (Показать все результаты (>35) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/jcs99.pdf
• http://cellmotility.genebee.msu.ru/html/articles/Grigoriev_2006a_CMC.pdf
• http://cellmotility.genebee.msu.ru/html/articles/Vorobjev03.pdf

... Variables representing the environmental conditions were `food' and `infection'. ... APPENDIX 1 An example of optimal life -history traits values (for a = 1.7 and m = 0.9) t 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 ... 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 z Et 2.3 2.5 2.7 2.8 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.8 3.9 4.0 4.0 4.1 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 4.2 ...

Еще в разделе: (Показать все результаты (>23) - ecology.genebee.msu.ru/ )

• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/1999_Seasons_EER.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Dimorph_HumBiol.pdf
• http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf

... Phys . 40 (2007) 329-342 doi:10.1088/0953-4075/40/2/006 Linear magnetic and alignment dichroism in Auger - photoelectron coincidence spectroscopy F Da Pieve1, S Fritzsche2, G Stefani1 and N M Kabachnik3,4 1 2 3 4 CNISM Institut f Е Fakultat Institute ... Received 20 September 2006, in final form 24 November 2006 Published 3 January 2007 Online at stacks.iop.org/JPhysB/40/329 Abstract Auger - photoelectron coincidence measurements for ... the cross section. ... Phys. Conf. ... Methods Phys....

Еще в разделе: (Показать все результаты (>90) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/PhysRevA73_06_062712Kabach_Kazanski.pdf
• http://danp.sinp.msu.ru/LIIWM/JPhysB33_2000_5045Khodyrev.pdf
• http://danp.sinp.msu.ru/LIIWM/JPhysB40_2007_F299Kab.pdf

Application of the V--Ray Technology for Optimization of the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D Supercomputers Alexander S. Antonov, Vladimir V. Voevodin Moscow State University, Russia eґmail: voevodin@vvv.srcc.msu.su Abstract The paper shows an application of the soґcalled Vґ Ray Technology for optimizing the TRFD and FLO52 Perfect Club Benchmarks to CRAY Y--MP and CRAY T3D supercomputers. ... Results for CRAY YґMP supercomputers. al structure of the program. ...

Еще в разделе: (Показать все результаты (>2) - asa.guru.ru/ )

... 8 DOI: 10.1093/nar/gkh583 Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli Maria M. Anokhina1, Andrea Barta2, Knud H. Nierhaus3, Vera A. Spiridonova4 and Alexei M. Kopylov1,4,* Department of Chemistry ... University, 119992 Moscow, Russian Federation Received February 5, 2004; Revised March 22, 2004; Accepted April 14, 2004 1 ABSTRACT Tetracycline blocks stable binding of aminoacyltRNA to the bacterial ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf

... These spectral characteristics compare with introduction (ВВЕДЕНИЕ) At last time many workers have studied thermal Rayleigh-Benard convection using numerical At last time many workers have studied thermal Rayleigh- Benard convection using numerical time many At last time many workers have studied thermal Rayleigh-Benard convection using numerical used spectral methods with periodic boundary conditions. ... In numerical simulations were derived secondary stationary, [pic] where ? ...

Еще в разделе: (Показать все результаты (>17) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2006/CD/Palymskiy2.doc
• http://hit-conf.imec.msu.ru/2006/CD/Palymskiy2.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• ConClus

... The surface mixed layer of the ocean is often characterized by density compensation between the horizontal temperature and salinity gradients. ... The coupling arises through a nonlinear diffusion operator proportional to the buoyancy gradient, which parameterizes the combined effect of slumping and mixing of small-scale horizontal buoyancy gradients. ... Mesoscale stirring will create small-scale temperature and salinity gradients by stretching and folding the large scale thermohaline patterns. ...

Еще в разделе: (Показать все результаты (>12) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/stathyd/2005%20Smyth%20et%20al.%2C%20Differential%20diffusion%20in%20breaking%20Kelvin-Helmholtz%20billows.pdf
• http://ocean.phys.msu.ru/courses/geo/lectures-addons/02/2009%20Bromm%20et%20al.%2C%20The%20formation%20of%20the%20first%20stars%20and%20galaxies.pdf
• http://ocean.phys.msu.ru/courses/geo/lectures-addons/02/2006%20Wood%20et%20al.%2C%20Accretion%20of%20the%20Earth%20and%20segregation%20of%20its%20core.pdf

MGU Botanic Garden . ... The MSU Botanical Garden is not only a valuable scientific institution, but also a place giving joy and a good mood to many people. ... To become a volunteer, please, fill in the application e-form and send it to the following e-mail address: . ... We will contact you on your telephone number within a week of your sending the application. Community work days are also held on the territory of the Garden for different organization and agency workers. ...

Еще в разделе: (Показать все результаты (>11) - botsad.msu.ru/ )

... In 1964 at the Institute of Mechanics of Lomonosov Moscow State University the laboratory of physical-chemical gasdynamics had been set up under the supervision of Tirskiy G.A., which employed a team of three scientists - Tirskiy G.A., Gershbein E.A., Suslov O.N.; before they worked in the general hydromechanics division. ... V.N. Chelomey Medal of Astronautics Federation of Merit for the National Astronautics (2004, Kovalev V.L., Sakharov V.I., Tirskiy G.A.). ...

Еще в разделе: (Показать все результаты (>3) - lab106.imec.msu.ru/ )

... Master's Programme . ... On-line консультант . ... Master s Programme Enterprise Resource Management System has been developed basing on methodology from SAP, Oracle, Microsoft Companies, as well as the experience of national higher school and international universities. The key objective (mission) of the Programme is to educate professionals in the organization and implementation of projects aimed at deployment and maintenance of ERP systems at domestic enterprises. ...

Еще в разделе: (Показать все результаты (>4) - erp.cmc.msu.ru/ )

... On the Geological and Physical Mechanisms of Natural Processes in Dynamic Geology Problems N. V. Koronovskii, A. A. Naimark, V. S. Zakharov, and G. V. Bryantseva Department of Geology, Moscow State University, Moscow, Russia e mail: koronovsky@rambler.ru, fnaim@ya.ru, vszakharov@yandex.ru, bryan@geol.msu.ru Received March 30, 2015 Abstract--The applicability of the abstract physical mechanisms in studies of concrete geological processes is considered. ... MOSCOW UNIVERSITY GEOLOGY BULLETIN Vol. ...

Еще в разделе: (Показать все результаты (>19) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_Simonov_2010_eng.pdf
• http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_etal_2015_eng.pdf
• http://dynamo.geol.msu.ru/personal/vsz/papers/Zakharov_2013_3_eng.pdf

... Catalog . ... This web application is brought to you by the following people (in alphabetical order): . Alexey Sergeev, markup issues . Artemy Tregoubenko , JavaScript code . Elena Glushkova, content management . ... We would like to acknowledge the usage of these open source technologies: . Django , web framework . PostgreSQL , database management system . ... SAMP-Webtools , set of JavaScript tools for SAMP-enabled web applications . Developed by the Team . ...

Еще в разделе: (Показать все результаты (>210) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Berkeley 53
• SAI OCL Catalog Berkeley 72
• SAI OCL Catalog Berkeley 71

... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

Еще в разделе: (Показать все результаты (>2) - scon155.phys.msu.ru/ )