... PDF created with pdfFactory trial version www.pdffactory.com 2 . ... 2001. ... 1977. ... 1987. ... 1983, 1987. ... 1985. ...

Еще в разделе: (Показать все результаты (>35) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/Crimea/win_right~eng.html

... Local similarities and pairwise sequence alignment . ... Multiple sequence alignment . ... This includes representation in corresponding databases of information about structurally and functionally important fragments and patterns, taking into account obtained statistical information about sequences and three-dimensional structure data. ... The alignment procedure for each shift of the sequences finds in the local similarity map a series of non-overlapping diagonal segments and computes its power. ...

Еще в разделе: (Показать все результаты (>216) - www.genebee.msu.ru/ )

• Biochemistry (Moscow), Vol
• IGLA-3D User Guide
• BioSystems, 30 (1993) 57-63 57

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

... Modern model for capitalist society as market relations form fails to satisfy the needs of society' social development, and strongly requires to create new social knowledge structure and new approach for inequality sociology theory development. Our study conceptual logic comprises routine, philosophic and ideological reflexions analysis to create new social inequality definition in the context of new sociologic knowledge structure. ...

Еще в разделе: (Показать все результаты (>71) - www.socio.msu.ru/ )

• Вестник МГУ

... Our primary objective is the design and implementation of applied software tools for data processing, output and circulation of computer literature. ... Software tools for signal processing in medicine and engineering CONAN-m and CONAN-t. Statistical stable analysis tool for regression and factor models SIGN. ... Figurnov V.A. "IBM PC for Users" (in Russian). ... Boldin M.V., Simonova G.I., Tyurin Yu.N. "Sign Statistical Analysis of Linear Models" (in Russian and in English ). ... InCo . ...

Еще в разделе: (Показать все результаты (>3) - statsoft.msu.ru/ )

... Journals . Memoirs of the Faculty of Physics . Moscow University Physics Bulletin . ... The conference papers from the School-Seminar ?Waves-2014? will be submitted for publishing in the Memoirs of the Faculty of Physics journal. ... Moscow University Physics Bulletin was founded in 1946 by Lomonosov Moscow State University and the Faculty of Physics. ... World-known physicists working at the Faculty of Physics (including 8 Nobel laureates) used to be and are the authors of the journal. ...

Еще в разделе: (Показать все результаты (>8) - vmu.phys.msu.ru/ )

The Department of Talented Youth Affairs and Professional Orientation . ... The Faculty of Journalism of Moscow State University has announced the contest for the design creation of ?Space University? logotype and emblem. ... Criteria for the appraisal of the design: . ... Contest dates: from February 15, 2016 till May 15, 2016. For more information about the contest visit the website: www.journ.msu.ru . ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>59) - talant.msu.ru/ )

• admin | The Department of Talented Youth Affairs and Professional Orientation
• editor | The Department of Talented Youth Affairs and Professional Orientation
• News | The Department of Talented Youth Affairs and Professional Orientation |

... defmacro defprinter ( name args &body body ) . ... body ) ) . ... defprinter :property ( type name &rest body ) . print-statement-with-body stream body nil "public ~a ~a" type name ) ) . ... defprinter :get ( &rest body ) . print-statement-with-body stream body nil "get" ) ) . ... defprinter :constructor ( name args &rest body ) . ... defprinter :class ( name &rest body ) . print-statement-with-body stream body t "public class ~a" name ) ) . ... defprinter :namespace ( name &rest body ) . ...

Еще в разделе: (Показать все результаты (>2) - depni.sinp.msu.ru/ )

The Laboratory of the Historical Information Science . ... The historical information science laboratory was founded within the structure of the source studies department on 8 December 1995 for the purpose of fulfilling the decision of the academic council of the History Faculty of 4 October 1991 about the transformation of a group for the application of mathematic methods and mainframes in historical research in the laboratory of historical information sciences. ... Senior laboratory assistant (2) . ...

Еще в разделе: (Показать все результаты (>4353) - www.hist.msu.ru/ )

• Editions
• ЭОС истфака МГУ: Кафедра исторической информатики
• ЭОС истфака МГУ: Course categories

... UHECR SINP MSU . About laboratory . ... mini-EUSO (UV atmosphere) . News . UHECR news . ... Publications . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... Similarity analysis of the streamer zone of Blue Jets . ... It was also noticed that BJ are similar to the streamer zone of a leader (streamer corona) and the modeling studies based on the streamers fractal structure were conducted. ... The energy spectrum of X-rays from rocket-triggered lightning . ...

Еще в разделе: (Показать все результаты (>45) - uhecr.sinp.msu.ru/ )

• Publications UHECR
• UHECR news
• Space experiment TUS on board the Lomonosov satellite as pathfinder of JEM-EUSO

... Journal title [?] Main publisher . ... medicine . ... Blackwell Publishing ] . ... BioMed Central ] . ... American Journal of Neuroradiology . ... American Journal of Tropical Medicine and Hygiene . ... BMC Anesthesiology . ... BMC Cancer . ... BMC Cardiovascular Disorders . ... BMC Clinical Pathology . ... BMC Clinical Pharmacology . ... BMC Dermatology . ... BMC Endocrine Disorders . ... BMC Medicine . ... BMC Pulmonary Medicine . ... Nature Publishing Group ] . ... JCatalog | Journal list . ...

Еще в разделе: (Показать все результаты (>1457) - journals.genebee.msu.ru/ )

• JCatalog - publisher index
• JCatalog >> Journal information >>
• JCatalog - Science Magazines Catalog

... Key words: economic geography, firms strategies, management, Europe . Vyacheslav N.аKonishchev Department of Cryolithology and Glaciology, Faculty of Geography, Lomonosov Moscow State University, Moscow, Russia . E-mail: vkonish@mail.ru . ... Center for Permafrost (CENPERM), Department of Geosciences and Natural Resource Management, University of Copenhagen, ?ster Voldgade 10, 1350 Copenhagen K, Denmark . ... Faculty of Geography, Lomonosov Moscow State University, Moscow, Russia . ...

Еще в разделе: (Показать все результаты (>467) - www.geogr.msu.ru/ )

• Фотографии юбилея
• foot much roland suited representing an oliver up integument critique...
• CONTENT 1?(8)?2015

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

. Number . Task . Pri . Author . Created By Tool . Created On . Modified On . Completed . Modified By . Assigned To . Link To . Magic . Description

Еще в разделе: (Показать все результаты (>53) - genphys.phys.msu.su/ )

• To Do List History

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Higher School of Management and Innovation (Faculty of Lomonosov MSU) was founded in June 2006 by the Academic Council on the initiative of the Moscow State University Rector, academician V.A. Sadovnichiy and Chairman of the Board of Directors of JSFC "Sistema" V.P. Yevtushenko. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• Message from Victor Antonovich Sadovnichy - Rector of Lomonosov Moscow State
• Admission committee | MSU Higher school of management and innovation

Space Weather . ... Main page . ... Data . ... Data base . Satellite trajectory viewer . ... Storage and processing of space experiments, in conjunction with the Internet access system, are the main components of the system of space monitoring. ... CORONAS-F . ... The space monitoring data base contains measurements of domestic satellites since 1983. ... Now the data base continues to be filled up in line with the operational satellites connection timetable(Meteor-M ?1, Electro-L ?1). ...

Еще в разделе: (Показать все результаты (>13) - swx.sinp.msu.ru/ )

• SWX - Главная

... Carbamide . ... Moscow ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics  was established by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...

Еще в разделе: (Показать все результаты (>93) - td.chem.msu.ru/ )

• Lora S. Nikolaeva Laboratory of Chemical Thermodynamics
• Research Areas Laboratory of Chemical Thermodynamics

... 2000 .. ... Y3Al2(AlO4)3 Y3Fe2(FeO4)3 CaF2 ZnS , , , 0,24ґ6,00 1,1ґ1,5 0,15ґ12 0,4ґ14 0,65 2,5 8,0 0,65 11,0 4,8 9,0 1320 1200 82 363 243 164 590 343 527 489 106, K-1 8,2 14 18,4 7,4 (293 ), /( ) 0,13 6,7ґ8,0 ґ 17,2 La2S 3 0,5ґ25 8ґ12 8ґ14 10,0 14,8 14,4 ґ 1,7 ґ CaLa2S4 SrLa2S4 94 , 6, 2, 2000 , , La2S3 , Ce2S3 , Gd2S3 , Tb2S3 , Tm2S3 , Yb2S3 . La2S3 , 1170 -La2S3 , 1570 -La2S3 ( () Th3P4). ... MeS, -Ln2S3 MeLn2S4 (CT Th3P4). ... CaLa2S4 CaS + - CaLa2S4 . ... CaO La2O3 , , ґ CaLa2S4 , CS2 1270 .. ...

Еще в разделе: (Показать все результаты (>173) - www.pereplet.ru/ )

• Super Ratio

. TRANSITSEARCH . HOME . Photometric Search Results . A results page has not yet been created for this known transiting planet. RETURN to Candidates table.

Еще в разделе: (Показать все результаты (>45) - observ.pereplet.ru/ )

• Candidate Assignments

Courses Overview Human resources management (English) The course is aimed at creating an overall understanding of human resources (HR) management system. ... Key topics: main theories and concepts of human resources management, personnel planning, HR policies, personnel selection and hiring, personnel development, career management. ... Insurance and risks The course presents an overview of economic, legal, and administrative bases of insurance. ... Key topics: depending on a company profile. ...

Еще в разделе: (Показать все результаты (>157) - www.mgubs.ru/ )

• Высшая школа бизнеса МГУ им. Ломоносова
• The Ljubljana Summer school
• Выпуск 2/2011 | Высшая школа бизнеса МГУ им. Ломоносова