... Air temperature in the forechamber: 285-295K . ... Aerodynamic unit AR-2 is used for experimental research of heat and mass exchange processes in a model boundary layer, flown over by supersonic air stream. The main part of the unit is supersonic aerodynamic tube of continuous action with regulated plate nozzle, rectangular cross-section of the working part 100x70 and with regulated exit cone. ... Unit AR-2 is a supersonic aerodynamic tube with a regulated supersonic nozzle and an exit cone. ...

Еще в разделе: (Показать все результаты (>6) - termogaz.imec.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...

Еще в разделе: (Показать все результаты (>9) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./nekipelov.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./paliulis_chlivickas.pdf

A GENETIC ALGORHYTM FOR OPTIMIZING A NEURAL NETWORK CAPABLE TO LEARN FOR FOOD SEARCHING IN A RADIAL MAZE Budilova E.V., Chepurnova N.E., Chepurnov S.A, Teriokhin A.T. M.V.Lomonosov Moscow State University, Dept. of Biology. ... The upper platform has a hole in the middle and several radially directed tubular canals ("arms") each of which can contain a peace of food and has doors opening only in the centrifugal direction. ... The task of the animal is to visit only those arms which contain food. ...

Еще в разделе: (Показать все результаты (>36) - ecology.genebee.msu.ru/ )

• Кафедра общей экологии

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Electronic Proposal Submission Service - EPSS preparation and submission guide - Release Date: 5 May 2008 Table of Contents 1 1 .1 . ... Using PIC in EPSS.. ... 29 EPSS help desk Phone: +32 2 23 33 760 Email: support@epss-fp7.org EPSS User Manual Released on 5 May 2008 page 2 of 29 1 EPSS Preparation ­User's Guide The EPSS (Electronic Proposal Submission Service) allows Proposers to create their proposal completely on-line without downloading or saving anything on their local personal computer. ...

Еще в разделе: (Показать все результаты (>36) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/ERC_guide_preparation.pdf
• http://ideas.msu.ru/docs/Official_rules.pdf
• http://ideas.msu.ru/docs/ERC_rules.pdf

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>6) - www.bio.msu.ru/ )

• Master In Nanobiotechnology ? Биологический факультет МГУ

Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . You may download the latest source code distribution and install the period search service at your own web server. ...

Еще в разделе: (Показать все результаты (>2) - scan.sai.msu.ru/ )

XXIII ICTAM, 19­24 August 2012, Beijing, China CASES OF INTEGRABILITY IN DYNAMICS OF A RIGID BODY INTERACTING WITH A RESISTANT MEDIUM Maxim V. Shamolin Institute of Mechanics, Lomonosov Moscow State University, Moscow, 119899, Russian Federation Summary The author discovers new integrable cases of the rigid body motion in a resisting medium, including those in the classical problem of motion of a spherical pendulum placed in the over-running medium flow. ...

Еще в разделе: (Показать все результаты (>41) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-115.pdf
• http://shamolin2.imec.msu.ru/art-160-1.pdf
• http://shamolin2.imec.msu.ru/art-141-1.pdf

... Changed pages: posts/seminar-24.03.2016 . Changed by: alexeybrazhe . Commit type: git . ... Changed pages: posts/seminar-03.12.2015 . ... Changed pages: posts/seminar-25.12.2014 . ... Changed pages: posts/seminar-03.03.2015 posts/seminar-10.03.2015 . ... Changed pages: local.css posts/seminar-03.03.2015 . ... Changed pages: local.css posts/seminar-24.09.2013 . ... Changed pages: local.css media/files/seminar-24.09.2013.2.png media/files/Киселева автореферат.doc posts/seminar-24.09.2013 . ...

Еще в разделе: (Показать все результаты (>5) - cell.biophys.msu.ru/ )

• CellBioph/Publications

NEW ECONOMIC SCHOOL .. BSP/2007/094 R 2007 " " .. ... On The Dynamics of People's Unions / Working Paper # BSP/2007/094 R. - Moscow, New Economic School, 2007. - 19 p. (Rus.) ... Key words: public economics, allocation theory, size of nations ISBN ї .. ... x[0,1] - (FOC) FOC: (W1 (x) + W2 (1 - x)) = 0, x (1) - (SOC) SOC: 2 (W1 (x) + W2 (1 - x)) 0. x2 (2) , (1) (2), .. ... Grossman & Mendoza, 2001, 2004) , , , : , . ... On the Number and Size of Nations", Quarterly Journal of Economics Vol. ...

Еще в разделе: (Показать все результаты (>8) - belyakov.imec.msu.ru/ )

. Fig. 2. A - Thermodependent changes of PSI delayed fluorescence intensity (1) and chlorophyll bleaching rate (2-5) in the S. elongatus membranes at I=8 W m -2 . 2-5 - rates of chlorophyll bleaching in control (2), in presence of 1 mM MgBr 2 (3), 2 mM sodium ascorbate (4) and anaerobic conditions (5). B - Correlation between DF intensity and rate of chlorophyll bleaching in control obtained at temperatures: 60 (1); 65 (2); 70 (3); 75 (4); 78 (5) and 80 (6) o C.

Еще в разделе: (Показать все результаты (>5) - biophys.msu.ru/ )

• Stress of plant cells
• One of the informative characteristics of the reverse electron transport in the

Полиароматические гидрокарбоны в донных отложениях Баренцева моря: динамика за последние 10 лет. ... Сравнение двух групп данных, полученных в указанные выше периоды времени, показало незначительную разницу между средним значением концентраций и составом PAHs в донных отложениях в 3-х исследуемых участках Баренцева моря. В юго-западной части моря средняя общая концентрация PAHs, полученная в девяностые годы, также незначительно отличается от данных, полученных в двухтысячные годы. ...

Еще в разделе: (Показать все результаты (>6) - ecoinformatica.srcc.msu.ru/ )

• http://ecoinformatica.srcc.msu.ru/print_html.php?keyword=&num_records=1&theme=5&subtheme=37&from=&ref_ind=0305000705

DICE .. 1 1 . .. " ", 27 2007 DICE " Dynamic Integrated Model of Climate and Economy" W.D. Nordhaus Managing the global commons: the economics of climate change MIT Press, 1994 K (t ) ­ (. US$, 1989.) M (t ) ­ CO2 (. ) T (t ) ­ ( C) T (t ) ­ ( C) s (t ) ­ , 0 s (t ) 1, µ(t ) ­ CO2 , 0 µ(t ) 1 DICE 27.03.2007 2/3 . () () Q (t ) = (t )A(t )K (t ) L(t )1 - (t ) ­ A(t ) ­ ( ) K (t ) ­ L(t ) ­ (..) ­ K (t ) = s (t )Q (t ) - K K (t ) s (t ) ­ s (t )Q (t ) ­ K ­ . () DICE 27.03.2007 3/3

Еще в разделе: (Показать все результаты (>2) - oc.cs.msu.su/ )

The Astronomical Journal welcomes new submissions at IOP Publishing . ... From: Andrew Wray < andrew.wray@iop.org > . ... On behalf of the IOP-AAS Project Team, I am delighted to announce that IOP Publishing is now processing all new submissions to the AJ. Submitting a new article . To submit a new article to the journal, go to http://authors.iop.org/aj , where you will find our beta version of the new AJ web submission site. ... Refereeing an article . ... IOP Publishing . ...

Еще в разделе: (Показать все результаты (>97) - sai.msu.ru/ )

• Презентация PowerPoint
• General Catalogue of Variable Stars: Variability Types
• А С Т Р О К У Р Ь Е Р

... 2000 June 21 . Solstice Celebration . ... Each individual image highlights a different temperature regime in the upper solar atmosphere and was assigned a specific color; red at 2 million, green at 1.5 million, and blue at 1 million degrees C. The combined image shows bright active regions strewn across the solar disk, which would otherwise appear as dark groups of sunspots in visible light images, along with some magnificent plasma loops and an immense prominence at the righthand solar limb. ...

Еще в разделе: (Показать все результаты (>14) - www.arcetri.astro.it/ )

. Fig. 5. Thermodependent changes of carotenoid bleaching rate in the S. elongatus membranes at I=50 W m -2 .

Еще в разделе: (Показать все результаты (>12) - www.biophys.msu.ru/ )

• Chlorophyll Fluorescence in vivo: A Theory
• Как отмечалось выше, обилие (по Fo) и фотосинтетическая активность

. Change telephone number . Maxim A. Klepikov 30 апреля 2003 19:09:43 . ******* Проект Экологическое Содружество: www.ecocoop.ru ******* . Доргие коллеги, . наш Яртелеком внезапно . и без предупреждения . сменил мне номер домашнего телефона. Теперь это 734610. Поблагодарим же заржавшегося монополиста . за эту выходку... С уважением, . Клепиков М.А. --- . Maxim A. Klepikov, . e-mail: . http://www.fadr.msu.ru/ecocoop/klep.html . Max's art: http://www.yaroslavl.com/VGallery/Klepikov .

Еще в разделе: (Показать все результаты (>15) - www.ecocoop.ru/ )

... Journal of Solid State Electrochemistry , 2003, v.7, p.122-124. ... An electrochemical cell of potentiometric type Na 0.5 WO 3 (reference electrode)/Na + -solid electrolyte/PbS (working electrode) capable of rapid and selective changing of the electromotive force value owning to H 2 S concentration variations in gas surroundings has been investigated at 295±1 K and a relative humidity of 52%. The sensitivity of this cell was 130 mV/decade at a H 2 S concentration within the range 13-130 ppm. ...

Еще в разделе: (Показать все результаты (>23) - www.inorg.chem.msu.ru/ )

... Do those millions of sites and services provide useful information, or are they just "information pollution"? ... Abstract This is a review of electrochemical information and services available on the internet, and some evaluation of their usefulness for professionals, students, and the general public. ... Two examples are the "Internetchemistry" site [26] and the "Electrochemical Science and Technology Information Resource (ESTIR)", which lists over 1,000 links to electrochemistry-related sites [7]...

Еще в разделе: (Показать все результаты (>60) - electr003.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/rus/novogilova.pdf
• Nanostructured SnO2-TiO2 films as related to lithium intercalation
• Inorganic Barrier Layers: Electron Transfer on Mercury Modified by Tungstate

... Publications . Journals . ... Ivanov A. P. , Erdakova N. N. On a mechanical lens . ... Abstract pdf (548.99 Kb) . In this paper, we consider the dynamics of a heavy homogeneous ball moving under the influence of dry friction on a fixed horizontal plane. ... pdf (548.99 Kb) Journal Info . ... http://mipt.ru/science/trudy/ . ... Ivanov A. P. , Shuvalov N. D. , Ivanova T. B. On detachment conditions of a top on an absolutely rough support . ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>106) - ics.org.ru/ )