ARTICLE IN PRESS N IM B Beam Interactions with Materials & Atoms Nuclear Instruments and Methods in Physics Research B xxx (2005) xxx­xxx www.elsevier.com/locate/nimb Gas cluster ion beam infusion processing of semiconductors R. MacCrimmon *, J. Hautala, M. Gwinn, S. Sherman Epion Corporation, 37 Manning Road, Billerica, MA 01821, United States Available online Abstract The application of gas cluster ion beam (GCIB) infusion in advanced IC fabrication is described. ... B xxx (2005) xxx­xxx Fig. ...

Еще в разделе: (Показать все результаты (>109) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Articles_GSIB/nimb_sputteryield_sizeclasterion.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb_GCIB_processing_Swenson.pdf
• http://danp.sinp.msu.ru/LAS/Nimb254_jan07_200Shulga.pdf

... Otherwise we will never recognize you and your homeworks. ... Afterwards you can go ahead and upload your homework to the system. You can also find your rating. ... To upload Homework - choose the corresponding task and press "Submit". labadmin's blog . ...

Еще в разделе: (Показать все результаты (>64) - nanolab.phys.msu.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>328) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Таблетка-чип, заменяющая врача. умная таблетка, smart...
• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC
• Клуб выпускников МГУ: Конференция "Выпускники ВМиК"

May 12, 1998 NOTES from May 9, 1998: The format of the Solar Event Lists was changed to include a standard SEC style header. ... Please send comments and suggestions to sec@sec.noaa.gov # # Missing data: //// # # Edited Events for 1998 May 11 # # Event Begin Max End Obs Q Type Loc/Frq Particulars Reg# #------------------------------------------------------------------------------- 2560 A0146 //// 1225 HOL ... The UT day of the event's begin time is the UT day of the list. ...

Еще в разделе: (Показать все результаты (>20) - dbserv.sinp.msu.ru/ )

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... X-COM: Distributed Computing Software . ... In mellow autumn time Moscow cordially invites HPC specialists to take part in Russian Supercomputing Days, the brand new international supercomputing conference that unites several traditional Russian and international HPC events. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Russian Supercomputing Days International Conference . ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• Nationwide Supercomputing Education Project | Moscow University Supercomputing
• Supercomputing Education Project | Moscow University Supercomputing Center
• APPLICATIONS: Astronomy | Moscow University Supercomputing Center

... Course ?Microcontroller Programming? is presented in two formats: . 32-bit microcontrollers . ... Acquired skills: practical skill of microcontroller programming on C; working with standard peripherals such as UART, digital display, ADC, pulse-width modulator, timer, etc. ... The duration of each special course within the frames of this program is two semesters. Each semester has 12 obligatory classes of four (4) academic hours each once a week, which totals in 48 hours per semester. ...

Еще в разделе: (Показать все результаты (>22) - engineering.phys.msu.ru/ )

• Introduction to Linux
• FPGA Design
• MEMS Seminars, ST, Renesas

European Treaty Series - No. 165 CONVENTION ON THE RECOGNITION OF QUALIFICATIONS CONCERNING HIGHER EDUCATION IN THE EUROPEAN REGION Lisbon, 11.IV.1997 2 ETS 165 ­ Recognition Qualifications Higher Education in the European Region , 11.IV.1997 The Parties to this Convention , Conscious of the fact that the right to education is a human right, and that higher ... 3 6 ETS 165 ­ Recognition Qualifications Higher Education in the European Region, 11.IV.1997 Section III. ...

Еще в разделе: (Показать все результаты (>41) - www.socio.msu.ru/ )

• Вестник МГУ
• English version - Социологический факультет МГУ

... We designed a prototype of a direction-sensitive optical mo dule (DOM) and we accordingly mo dified the simulation and reconstruction codes [2] currently used by the ANTARES Collaboration to study the response of the detector. The DOM is based on a position-sensitive photomultiplier coupled to a light guide system such that all the Cherenkov light arriving from the same direction is fo cussed on a reduced area of the photo catho de. ... Left: standard optical module; right: DOM. ...

Еще в разделе: (Показать все результаты (>19) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%202.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20NEMO.pdf
• http://antares.sinp.msu.ru/docs/INFN%20-%20Paper%203.pdf

WERE HITTITE KINGS DIVINELY ANOINTED? ... This is the only clear evidence that the gods were thought to be personally responsible for the anointment of Hittite kings. ... I am arguing that anointment with oil was extended to both Hittite priestly kings and certain other categories of Hittite priests, and that the underlying purpose of this act was ritual cleansing. ... Its beginning is preserved in two mutually complementing parallel versions KUB 35.165 Obv. ... the priest, son of the king'. ...

Еще в разделе: (Показать все результаты (>17) - imk.msu.ru/ )

• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/lydian.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/sippanti.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/refl-ucla.pdf

... Let us recall the principle of correlation of maxima and the method of dating of Suppose that a historical period from the year A to the year B in the events based on it. history of a region G ( i.e ., a state, a city, etc.) has been described in a fairly comprehensive year-by-year text (chronicles, annals, etc.), i.e ., the text X is split into sections or chapters X(T), each of which describes the events of one year T. We calculate the ... Let us briefly describe this measure. ...

Еще в разделе: (Показать все результаты (>84) - hbar.phys.msu.ru/ )

• http://hbar.phys.msu.ru/gorm/atext/steph4.pdf
• http://hbar.phys.msu.ru/gorm/atext/steph2003.pdf
• http://hbar.phys.msu.ru/gorm/fomenko/fomenko10.pdf

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ TSUNAMIGENIC POTENTIAL OF SUBMARINE EARTHQUAKES IN DIFFERENT REGIONS IN THE PACIFIC Viacheslav K. Gusiakov Institute of Computational Mathematics and Mathematical Geophysics, Siberian Division, Russian Academy of ... Fig. 1 shows the positions of 10 main tsunamigenic regions in the Pacific. ...

Еще в разделе: (Показать все результаты (>24) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E22_Watts.pdf
• http://seac47-2.phys.msu.ru/proc/E01_Armigliato.pdf
• http://seac47-2.phys.msu.ru/proc/Recommendations.pdf

.

Еще в разделе: (Показать все результаты (>3) - lab110.imec.msu.ru/ )

... Optical Zoomeron as a Result of Beatings of the Internal Modes of a Bragg Soliton B. I. Mantsyzov Faculty of Physics, Moscow State University, Vorob'evy gory, Moscow, 119992 Russia e-mail: mants@genphys.phys.msu.ru Received June 22, 2005; in final form, July 12, 2005 A new solution of two-wave MaxwellнBloch equations has been obtained analytically and numerically. ... The absence of losses on the emission of continuous spectrum waves indicates that the solutions found for the internal mode are...

Еще в разделе: (Показать все результаты (>29) - genphys.phys.msu.su/ )

• http://genphys.phys.msu.su/rus/sci/photonics/PDF/9.pdf
• http://genphys.phys.msu.su/rus/sci/photonics/PDF/6.pdf
• http://genphys.phys.msu.su/rus/edu/mech.php3

... A new image object format suggested. ... DataPtr ­ pointer to image data row. ... Collections.Generic; System.Windows.Forms; Microsoft.JScript; Microsoft.JScript.Vsa; Microsoft.Vsa; } return result; // Reading script from file public static string ReadScriptFromFile( string fileName) { System.IO.StreamReader sr = new System.IO.StreamReader(fileName); string sScript = ; try { sScript = sr.ReadToEnd(); } catch (Exception ex) { //TODO } finally { sr.Close(); } } return sScript ...

Еще в разделе: (Показать все результаты (>118) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2011.ICIAR.Sorokin_Mizotin_Krylov.GaussLaguerreKeypoints.en.pdf
• Laboratory of Mathematical Methods of Image Processing
• Software projects | Laboratory of Mathematical Methods of Image Processing

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Programme Committee . ... Visa Requirements . Scientific Programme . Programme . ... To arrange a visa support letter you are kindly requested to send by e-mail the following information: . ... passport number, date of issue and validity, . ... telephone and fax numbers, . ... copy of a double-spread page passport. A DOUBLE-PAGE SPREAD COPY OF PASSPORT (with a photo) should be sent preferably as a JPG FILE or by fax 7 496 21 65 891. ... Visa coordinator: . ... Fax: +7 49621 65891 . ...

Еще в разделе: (Показать все результаты (>31) - www.elch.chem.msu.ru/ )

RUSSIAN version . ... Vladimir V. SHAKHPARONOV . ... Since 2008 works as a researcher in the Department of Vertebrate Zoology of the Faculty of Biology MSU. ... At present I work at my Ph.D thesis 'Spatial orientation of amphibians belonging to terrestrial and semiaquatic ecological groups' (scientific supervisor - assoc. prof. Sergei V. Ogurtsov ). ... August 12-16, 2003, St. Petersburg, Russian Journal of Herpetology, 12(Suppl.), pp.209-212. [download pdf-file] . ...

Еще в разделе: (Показать все результаты (>55) - vertebrata.bio.msu.ru/ )

• Sergei V. Ogurtsov

... Biol. (2001) 212, 275 } 294 doi:10.1006/jtbi.2001.2375, available online at http://www.idealibrary.com on Light-triggered pH Banding Pro5le in Chara Cells Revealed with a Scanning pH Microprobe and its Relation to Self-Organization Phenomena A. A. BULYCHEV*, A. A. POLEZHAEV-, S. V. ZYKOV?A, T. YU. ... When exposed to light, internodal cells of Chara and Nitella develop a pattern of alternating acid and alkaline bands along the cell length (Spear et al., ... LIGHT-CONTROLLED PATTERNS FIG. ...

Еще в разделе: (Показать все результаты (>37) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3345.pdf
• http://library.biophys.msu.ru/PDF/3329.pdf
• http://library.biophys.msu.ru/matorin/3397.pdf

Subscriber access provided by ST PETERSBURG STATE UNIV Article Obtaining Nernstian Response of a Ca -Selective Electrode in a Broad Concentration Range by Tuned Galvanostatic Polarization Maria A. Peshkova, Tomasz Sokalski, Konstantin N. Mikhelson, and Andrzej Lewenstam Anal. ... Chronopotentiometric curves (A) and calibration curves (B) obtained for a Ca ISE polarized by different cathodic currents, in solutions with different concentrations of CaCl2 containing 0.001 M KCl background. ...

Еще в разделе: (Показать все результаты (>60) - electr003.chem.msu.ru/ )

• Pages of history: Eh-Film
• Boris B. Damaskin

30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )