... MSU's HPC HISTORY . ... In 1956, Research Computing Center (RCC) of Moscow State University received its first computer тАЬStrelaтАЭ. ... BESM-6 computer was and still is considered to be of great importance to USSRтАЩs/RussiaтАЩs history of computer development. ... Same year RCC received its first BESM-6 computer, and despite its serial number 13 it proved to be lucky for the Center. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Excursions to Supercomputing Center ...

Еще в разделе: (Показать все результаты (>28) - hpc.msu.ru/ )

• Nationwide Supercomputing Education Project | Moscow University Supercomputing
• Supercomputing Education Project | Moscow University Supercomputing Center
• Russian Supercomputing Days: Together to be Stronger | Moscow University

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>3) - www.bio.msu.ru/ )

... The group led by Honorary Professor of Moscow State University, Laureate of the U.S.S.R. State Prize, A.D. Vinogradov, was organized in 1960s when Bioenergetics became a rapidly growing and expanding area of Biochemistry. ... In 1980, he was invited to New York State University as a visiting professor. ... According to the University official rating site, Prof. A.D. Vinogradov and Dr V.G. Grivennikova are on the list of the most frequently sited authors at the Moscow State University. ...

Еще в разделе: (Показать все результаты (>71) - biochem.bio.msu.ru/ )

• Site-directed mutagenesis of cytochrome c: reactions with respiratory chain
• Biochemistry Department of Moscow State University | Na,K-ATPase and its role
• Reversibility of nucleoside diphosphate kinase solubilization from the surface

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... Описание вакансии: . ... следующая вакансия . список всех вакансий . добавить вакансию . редактировать эту вакансию . ...

Еще в разделе: (Показать все результаты (>13) - www.chemport.ru/ )

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>4) - theorphys.phys.msu.ru/ )

... 001.89:004 .. , .. , .. , .. , .. , .., .. e-mail: kryukov@theory.sinp.msu.ru RESTFUL-- 2012-4/882 RESTful-- , : , , , UNIDATA Common Data Model, , , , , , . ... NCEP/NCAR [1], , ). , . ... RESTful-- , : , , , UNIDATA Common Data Model [2], , , , , , . ... UNIDATA Common Data Model (CDM) [2]. ... UNIDATA CDM 3. ... XML . ... Unidata Common Data Model. : http://www.unidata.ucar.edu/software/netcdf-java/CDM/ [3]. ... Network Common Data Form (NetCDF). : http://www.unidata.ucar.edu/software/netcdf/ [5]...

Еще в разделе: (Показать все результаты (>2) - sinp.msu.ru/ )

... Based on the concept of -matrix and Choi­Jamiolkowski states we develop the approach of quantum process reconstruction. ... The approach is tested with the statistical reconstruction of the polarization transformations in anisotropic and dispersive media realized by means of quartz plates and taking into account the spectral structure of input polarization states. ... Knowing the input and measured (output) states, one can reconstruct the -matrix of the quantum process. ... Mixed state...

Еще в разделе: (Показать все результаты (>120) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2007-jetp(e)-104-736.pdf
• http://qi.phys.msu.su/papers/2007-os(e)-103-107.pdf
• http://qi.phys.msu.su/papers/2006-pra-73-063810.pdf

... Electronic journal Issue 4. 10 september 2004 Vorontchuk, Cox III R.W. Developing a Competency-based Career Training and Professional Development Program for Latvia INTRODUCTION. ... With the support of a grant from the NISPAcee a team from the Latvian School of Public Administration, the University of Latvia and the University of Akron (Ohio, USA) prepared for the Chancellery of Latvia a proposal for the creation of a career-long professional development program for those in the civil service. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>48) - electr003.chem.msu.ru/ )

• Pages of history: Eh-Film
• Galina A. Tsirlina: Eduard L. Nagaev. Scientific heritage
• Pronkin Sergey Nikolayevich

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>90) - comphep.sinp.msu.ru/ )

• new-mac [CompHEP]
• extra:main [CompHEP]
• extra:model:main [CompHEP]

... Master's Programme . ... On-line консультант . ... Master s Programme Enterprise Resource Management System has been developed basing on methodology from SAP, Oracle, Microsoft Companies, as well as the experience of national higher school and international universities. The key objective (mission) of the Programme is to educate professionals in the organization and implementation of projects aimed at deployment and maintenance of ERP systems at domestic enterprises. ...

Еще в разделе: (Показать все результаты (>4) - erp.cmc.msu.ru/ )

Prediction of physical properties of materials based only on their chemical composition has long been an intriguing task. ... The main interests of Prof. Lebedev 's group are physical properties of crystals exhibiting structural instability, in which different phase transitions (including the ferroelectric one) can appear. ... A.I. Lebedev. ... Physics of the Solid State 51 , 362 (2009) ; e-print arXiv:1305.0240 (2013) ; [local copy] . ... Physics of the Solid State 51 , 2324 (2009) ; [local copy] . ...

Еще в разделе: (Показать все результаты (>45) - scon155.phys.msu.su/ )

• Influence of Se, Pb and Mn impurities on the ferroelectric phase transition in
• Off-center impurity atoms in crystals

Dmitriy Mendeleev . ... Dmitry Ivanovich Mendeleev : A project of undergraduate students from School No.470 (St.Petersburg) . ... Brokhaus Online: Biography of Mendeleev in Russian . ... Original Periodic Table by Mendeleev . ... Mendeleev's "Principles of Chemistry" (4 Pts. in 2 Vols) . ... Mendeleev's house museum in the village Boblovo, Moscow region (in Russian) . Statue of Mendeleev in front of Chemistry Department at Moscow State University (from the article about Russian chemistry in Chem. ...

Еще в разделе: (Показать все результаты (>122) - www.chem.msu.ru/ )

• Конференция выпускников Химфака МГУ, работающих за рубежом
• THE ALTERNATION RULE: AN OLD HEURISTIC PRINCIPLE OR A NEW CONSERVATION LAW

... Probe flash (energy/duration) . ... 0.01 J / 0.01 ms . ... Submersible unit (dimension/weight) . Power supply unit (dimensions/weight) . ... 300 x 300 x 50 mm / 1 kg . ... Power supply . ... The complete set of PrimProd fluorometer consists of the following mainframes: submersible probe, 12 DC on-board block power supply, IBM-compatible computer, connecting cables and cable-rope. ... Submersible probe. ... On-board power block provides the necessary voltage (42 V) supply at the submersible probe. ...

Еще в разделе: (Показать все результаты (>8) - www.biophys.msu.ru/ )

30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

... Chilingarian, I., Melchior, A.-L., Zolotukhin, I. 2010: Analytical approximations of K -corrections in optical and near-infrared bands , MNRAS, v. 405, p. 1409 (also arXiv:1002.2360) . ... Calculator . ... calculate spectral energy distributions , K-corrections calculator , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...

Еще в разделе: (Показать все результаты (>5) - kcor.sai.msu.ru/ )

• K-corrections calculator (version 2010)

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... BDRG . ... DEPRON . ELFIN-L . ... The satellite ?Mikhailo Lomonosov? is based on the platform of the spacecraft ?Kanopus-B? developed by the All-Russia reasearch and development institute of electromechanics named after Iosiphyan (VNIIEM). ... Scientific equipment will weight about 120 kg, while the total weight of the satellite will be about 450 kg. ...

Еще в разделе: (Показать все результаты (>34) - lomonosov.sinp.msu.ru/ )

• News | Университетский спутник "Ломоносов"
• BDRG | Университетский спутник "Ломоносов"
• Mikhail Lomonosov ? the Pioneer of Russian Science | Университетский спутник

. Home . Structure of Data . Description . Catalog . Publications . VO . ЮБ 2000 . 11:14:20.2 . ЮД 2000 . -57:33:04 . l . 290.172 . b . 2.895 . diameter . 14.0' . (m - M) 0 . 11.4 0.05 . distance . 1900 50 pc . E(B - V) . 0.08 0.01 . log(t) . 9.65 0.05 . (J, J-H) isochrone VOTable . 2MASS data VOTable . Developed by the Team . Send us your questions or feedback

Еще в разделе: (Показать все результаты (>209) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Berkeley 53
• SAI OCL Catalog Berkeley 71
• SAI OCL Catalog Berkeley 72

Open Conference Systems . Conference Help . ... All Authors Title Abstract Index terms Full Text . ... Call for Papers (March 1, 2016 - June 1, 2016) . ... By Conference . ... It is incumbent on the authors to obtain appropriate approval to present their work to this international forum. 35-word Abstract : Your abstract should be a brief summary of your paper topic. If your paper is accepted, your 35-word abstract will be included in the Conference Program and the Technical Digest on CD-ROM . ...

Еще в разделе: (Показать все результаты (>17) - hea.phys.msu.su/ )

• Call for Papers