... Speech Recognition Engine 2.0 is a Windows-9x based computer program, allowing a User to utilize a multi-sensor setup consisting of several acoustic microphones, breath-sensor and lips movement detection sensor. ... The User can simply produce new spectral parameters dynamically calculated and saved in special cycled buffers called "channels". ... It is possible to produce special "speech detection" spectral channels using "speech detection" unary operation. ...

Еще в разделе: (Показать все результаты (>82) - www.intsys.msu.ru/ )

... Do those millions of sites and services provide useful information, or are they just "information pollution"? ... Abstract This is a review of electrochemical information and services available on the internet, and some evaluation of their usefulness for professionals, students, and the general public. ... Two examples are the "Internetchemistry" site [26] and the "Electrochemical Science and Technology Information Resource (ESTIR)", which lists over 1,000 links to electrochemistry-related sites [7]...

Еще в разделе: (Показать все результаты (>67) - electr003.chem.msu.ru/ )

... Дисциплины . ... On-line консультант . ... Главная Дисциплины Основы IT - менеджмента . Лектор и автор курса Козлов Д.Д. В курсе рассматриваются вопросы выстраивания экономически эффективной ИТ-инфраструктуры предприятия на основе сервисно-ориентированной модели ITSM. В рамках курса изучается библиотека IT Infrastructure Library и рассматриваются процессы управления информационно-коммуникационной инфраструктурой, предоставления и поддержки услуг. ... Copyright ВМиК МГУ , 2008 . ...

Еще в разделе: (Показать все результаты (>8) - erp.cmc.msu.ru/ )

... Host City . ... Aug 31, 10.00 Excursion to Dmitrov . Excursion to Dmitrov Visit the ancient Russian town of Dmitrov and shake hands with Yuri Dolgoruki, a medieval Russian prince, who incidentally happens to be also the founder of the city of Moscow. Dmitrov known as the Moscow's Nohern pearl is just 65 kilometers north of Moscow on the suburban road. ... Dmitrov finally entered the Moscow county in the 16th century, after a lengthy internal struggle among its princes. ...

Еще в разделе: (Показать все результаты (>14) - www.elch.chem.msu.ru/ )

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... Review in Theoretical and Applied Mechanics . ... The main approach in studying stability of linear systems when the parameters of the system are changed is based on the authors own research. ... In Chapter 9 the multi-parameter stability theory of periodic systems is analyzed. ... Reviewed by Professor Teodor M Atanackovic . ...

Еще в разделе: (Показать все результаты (>30) - mailybaev.imec.msu.ru/ )

Society NewS AwArdS ANd PrizeS RAS Awards 2006 Each year the RAS recognizes outstanding achievement in astronomy and geophysics by the award of medals and prizes. ... He is a Fellow of the Royal Society (1985), an Honorary Doctor of Science at Wroclaw University in Poland (1994), a Foreign Member of the Norwegian Academy of Science (1996), an elected member of Academia Europa (2001). ... Jose Barros-Pinto, London. ... Magda Vasta, Dept of Physics & Astronomy, University College London. ...

Еще в разделе: (Показать все результаты (>90) - sai.msu.ru/ )

• General Catalogue of Variable Stars: What's new.
• GCVS Research Group: History and Persons.

... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...

Еще в разделе: (Показать все результаты (>5) - ccoe.msu.ru/ )

• http://ccoe.msu.ru/sites/default/files/presentations/Moscow-Keynote-Hwu-10-22-2012.pdf

... Economic and Social Geography of Russia . ... The Natural Risk Assessment Laboratory . ... World Data Center for Geography . ... Russia s natural, economic and socio-demographic global potential . ... Supply and consumption of fresh water . Total supply and consumption of fresh water . Supply and consumption of fresh water per capita . ... Water pollution . ... Water consumption per capita. ... Sustainability of development of the environment in Russia . ... Development of Russia s industry . ...

Еще в разделе: (Показать все результаты (>61) - eng.geogr.msu.ru/ )

• Faculty of geography Lomonosov Moscow State University

... Conformational Analysis of Boron-Containing Compounds Using Gillespie-Kepert Version of Molecular Mechanics . ... Abstract - Molecular mechanics force field for boron-containing compounds based on CHARMM parameters and Gillespie-Kepert (GK) model is developed. ... The force field provides an accurate description of experimental X-ray stereochemistries in a wide range of organoboranes, organoborate complexes with polyhydroxy compounds, mixed oligomers of boric acid and borates. ...

Еще в разделе: (Показать все результаты (>42) - analyt.chem.msu.ru/ )

• Moscow State University: Analytical Chemistry Division

... Robert Hermann Brookline, MA (Received November 22, 1999) der to illustrate the obvious progress, one can mention a variety of examples. ... In or- FYI Item "BMS Report on Institutes" As a member of the panel commissioned by the Board on Mathematical Sciences of the National Research Council, I write to correct several inaccuracies in the "For your information" note by Allyn Jackson entitled "BMS Report on Institutes" in the December 1999 issue of the Notices. ...

Еще в разделе: (Показать все результаты (>75) - chaos.phys.msu.ru/ )

• Links
• Activities

FCNC Penguin Processes in Models Beyond the SM . ... The Standard Model (The SM) Simple extensions of the SM Supersymmetric models Extra dimensional models Strongly coupled and effecBve field theories The Standard Model : Standard Model of ParBcle Physics Simple extensions of the SM: Several models based on the SM that include one or more addiBonal parBcles, like a 4th generaBon, a second Higgs doublet or addiBonal colored scalars Supersymmetric Models : Various supersymmetric ...

Еще в разделе: (Показать все результаты (>152) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/Bunichev_QFTHEP2013.pdf
• http://qfthep.sinp.msu.ru/talks2013/qfthep_anom_tW.pdf

NATO Publishing Unit P.O. Box 17 3300 AA Dordrecht A U T H O R 'S D A T A B A S E E N T R Y S H E E T (to be submitted together with the scientific paper ) REFERENCE: ARW978587 TITLE OF THE NATO MEETING/ NATO ASI SERIES VOLUME : Use of Humic Substances to Remediate Polluted Environments: from Theory to Practice NAME OF THE DIRECTOR: Dr. Norbert ... The total space available for keywords and abstract of your paper is 900 characters (approx. 100 words). ...

Еще в разделе: (Показать все результаты (>134) - mgumus.chem.msu.ru/ )

• Intel Developer Forum, Spring 2008

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

... Field of interest: data analysis and interpretation of X-ray observations of BHC and NS systems, astrophysics of compact objects and related phenomena: X-ray , optical and radio observations , shocks and stellar winds, emission mechanism, the spectral and timing analysis of the X-ray emission from microquasars ( signature of accreting BH), atoll- and Z-sources ( signature of accreting NS), modeling of INTEGRAL images % . ...

Еще в разделе: (Показать все результаты (>15) - uranus.sai.msu.ru/ )

• Tatjana Khruzina

All your comments please send to Yagola Anatoly ( yagola@prof.msu.ru ) or to web-deseigners of the site ( ill-posed@mail.ru , nataschka_@mail.ru ).

Еще в разделе: (Показать все результаты (>30) - foroff.phys.msu.ru/ )

. Загружено: Vovez . Дата загрузки: 05.03.2010 . Размер: 77.6 Кбайт . Подпись: no comments . Описание: ...

Еще в разделе: (Показать все результаты (>4) - www.dubinushka.ru/ )

... I slept on my image of SN1999cq and decided to revisit my initial analysis, using "Submarine Sonar Subjective Analysis Techniques" (or whatever that means for - e.g. do we have a target or not ?) ... 1) LEHMANN's Image is great and matches Circular# 7209. ... 3) KERESZTY-ZOLT's Image shows only the very slightest hint for resolution of SN1999cq, in the generally diffused central area of UGX11268. 99.9% of what is marked as the ID for the supernova is actually the upper object shown in LEHMANN's...

Еще в разделе: (Показать все результаты (>429) - www.rochesterastronomy.org/ )

• Supernova 2002fk in NGC 1309
• Supernova 2009js in NGC 918
• Supernova 1999gi in NGC 3184

... О КАФЕДРЕ ? ... GENERAL INFORMATION ABOUT THE CHAIR . ... Кафедра ЮНЕСКО по изучению глобальных проблем и возникающих социальных и этических вызовов для больших городов и их населения на факультете глобальных процессов Московского государственного университета имени М.В. Ломоносова . ... Cоздание кафедры ЮНЕСКО на факультете глобальных процессов МГУ открыло новые возможности для научных исследований в области возникающих глобальных социальных и этических проблемљ и для их преподавания. ...

Еще в разделе: (Показать все результаты (>4) - unesco.fgp.msu.ru/ )

• News from the UNESCO Chair on Global Problems Кафедра ЮНЕСКО по изучению

... Семинары . ... UNИX . ... Immutable Page . Comments . ... Attachments . More Actions: Raw Text Print View Render as Docbook Delete Cache ------------------------ Check Spelling Like Pages Local Site Map ------------------------ Rename Page Copy Page Delete Page ------------------------ My Pages Subscribe User ------------------------ Remove Spam Revert to this revision Package Pages Sync Pages ------------------------ Load Save SlideShow . ... Участие в семинаре. ...

140. http://srd.sinp.msu.ru/nymmik/models/bazilevskaya_2.pdf